ID: 968925453

View in Genome Browser
Species Human (GRCh38)
Location 4:3544882-3544904
Sequence GCTGCTTCTGCCTGGCCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968925453_968925458 1 Left 968925453 4:3544882-3544904 CCTAGAGGCCAGGCAGAAGCAGC No data
Right 968925458 4:3544906-3544928 TGGGTTTCCACTCACACGGTAGG No data
968925453_968925461 22 Left 968925453 4:3544882-3544904 CCTAGAGGCCAGGCAGAAGCAGC No data
Right 968925461 4:3544927-3544949 GGTGGCTGTGCGATTTCGTCTGG No data
968925453_968925459 4 Left 968925453 4:3544882-3544904 CCTAGAGGCCAGGCAGAAGCAGC No data
Right 968925459 4:3544909-3544931 GTTTCCACTCACACGGTAGGTGG No data
968925453_968925457 -3 Left 968925453 4:3544882-3544904 CCTAGAGGCCAGGCAGAAGCAGC No data
Right 968925457 4:3544902-3544924 AGCATGGGTTTCCACTCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968925453 Original CRISPR GCTGCTTCTGCCTGGCCTCT AGG (reversed) Intergenic
No off target data available for this crispr