ID: 968925456

View in Genome Browser
Species Human (GRCh38)
Location 4:3544890-3544912
Sequence AAACCCATGCTGCTTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968925456_968925461 14 Left 968925456 4:3544890-3544912 CCAGGCAGAAGCAGCATGGGTTT No data
Right 968925461 4:3544927-3544949 GGTGGCTGTGCGATTTCGTCTGG No data
968925456_968925459 -4 Left 968925456 4:3544890-3544912 CCAGGCAGAAGCAGCATGGGTTT No data
Right 968925459 4:3544909-3544931 GTTTCCACTCACACGGTAGGTGG No data
968925456_968925462 23 Left 968925456 4:3544890-3544912 CCAGGCAGAAGCAGCATGGGTTT No data
Right 968925462 4:3544936-3544958 GCGATTTCGTCTGGAGTCCCCGG No data
968925456_968925458 -7 Left 968925456 4:3544890-3544912 CCAGGCAGAAGCAGCATGGGTTT No data
Right 968925458 4:3544906-3544928 TGGGTTTCCACTCACACGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968925456 Original CRISPR AAACCCATGCTGCTTCTGCC TGG (reversed) Intergenic
No off target data available for this crispr