ID: 968925458

View in Genome Browser
Species Human (GRCh38)
Location 4:3544906-3544928
Sequence TGGGTTTCCACTCACACGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968925451_968925458 14 Left 968925451 4:3544869-3544891 CCTGAACGCGGATCCTAGAGGCC No data
Right 968925458 4:3544906-3544928 TGGGTTTCCACTCACACGGTAGG No data
968925456_968925458 -7 Left 968925456 4:3544890-3544912 CCAGGCAGAAGCAGCATGGGTTT No data
Right 968925458 4:3544906-3544928 TGGGTTTCCACTCACACGGTAGG No data
968925448_968925458 16 Left 968925448 4:3544867-3544889 CCCCTGAACGCGGATCCTAGAGG No data
Right 968925458 4:3544906-3544928 TGGGTTTCCACTCACACGGTAGG No data
968925450_968925458 15 Left 968925450 4:3544868-3544890 CCCTGAACGCGGATCCTAGAGGC No data
Right 968925458 4:3544906-3544928 TGGGTTTCCACTCACACGGTAGG No data
968925453_968925458 1 Left 968925453 4:3544882-3544904 CCTAGAGGCCAGGCAGAAGCAGC No data
Right 968925458 4:3544906-3544928 TGGGTTTCCACTCACACGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968925458 Original CRISPR TGGGTTTCCACTCACACGGT AGG Intergenic
No off target data available for this crispr