ID: 968925459

View in Genome Browser
Species Human (GRCh38)
Location 4:3544909-3544931
Sequence GTTTCCACTCACACGGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968925450_968925459 18 Left 968925450 4:3544868-3544890 CCCTGAACGCGGATCCTAGAGGC No data
Right 968925459 4:3544909-3544931 GTTTCCACTCACACGGTAGGTGG No data
968925448_968925459 19 Left 968925448 4:3544867-3544889 CCCCTGAACGCGGATCCTAGAGG No data
Right 968925459 4:3544909-3544931 GTTTCCACTCACACGGTAGGTGG No data
968925453_968925459 4 Left 968925453 4:3544882-3544904 CCTAGAGGCCAGGCAGAAGCAGC No data
Right 968925459 4:3544909-3544931 GTTTCCACTCACACGGTAGGTGG No data
968925456_968925459 -4 Left 968925456 4:3544890-3544912 CCAGGCAGAAGCAGCATGGGTTT No data
Right 968925459 4:3544909-3544931 GTTTCCACTCACACGGTAGGTGG No data
968925451_968925459 17 Left 968925451 4:3544869-3544891 CCTGAACGCGGATCCTAGAGGCC No data
Right 968925459 4:3544909-3544931 GTTTCCACTCACACGGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968925459 Original CRISPR GTTTCCACTCACACGGTAGG TGG Intergenic
No off target data available for this crispr