ID: 968925461

View in Genome Browser
Species Human (GRCh38)
Location 4:3544927-3544949
Sequence GGTGGCTGTGCGATTTCGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968925456_968925461 14 Left 968925456 4:3544890-3544912 CCAGGCAGAAGCAGCATGGGTTT No data
Right 968925461 4:3544927-3544949 GGTGGCTGTGCGATTTCGTCTGG No data
968925453_968925461 22 Left 968925453 4:3544882-3544904 CCTAGAGGCCAGGCAGAAGCAGC No data
Right 968925461 4:3544927-3544949 GGTGGCTGTGCGATTTCGTCTGG No data
968925460_968925461 -9 Left 968925460 4:3544913-3544935 CCACTCACACGGTAGGTGGCTGT No data
Right 968925461 4:3544927-3544949 GGTGGCTGTGCGATTTCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968925461 Original CRISPR GGTGGCTGTGCGATTTCGTC TGG Intergenic
No off target data available for this crispr