ID: 968925462

View in Genome Browser
Species Human (GRCh38)
Location 4:3544936-3544958
Sequence GCGATTTCGTCTGGAGTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968925460_968925462 0 Left 968925460 4:3544913-3544935 CCACTCACACGGTAGGTGGCTGT No data
Right 968925462 4:3544936-3544958 GCGATTTCGTCTGGAGTCCCCGG No data
968925456_968925462 23 Left 968925456 4:3544890-3544912 CCAGGCAGAAGCAGCATGGGTTT No data
Right 968925462 4:3544936-3544958 GCGATTTCGTCTGGAGTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968925462 Original CRISPR GCGATTTCGTCTGGAGTCCC CGG Intergenic
No off target data available for this crispr