ID: 968925506

View in Genome Browser
Species Human (GRCh38)
Location 4:3545258-3545280
Sequence CTGGACACACAGATGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968925506_968925519 28 Left 968925506 4:3545258-3545280 CCTCTCTGCATCTGTGTGTCCAG No data
Right 968925519 4:3545309-3545331 CAGGAGTGTGGTGGGACATCCGG No data
968925506_968925513 16 Left 968925506 4:3545258-3545280 CCTCTCTGCATCTGTGTGTCCAG No data
Right 968925513 4:3545297-3545319 GAAGTCCCCAGGCAGGAGTGTGG No data
968925506_968925515 20 Left 968925506 4:3545258-3545280 CCTCTCTGCATCTGTGTGTCCAG No data
Right 968925515 4:3545301-3545323 TCCCCAGGCAGGAGTGTGGTGGG No data
968925506_968925511 9 Left 968925506 4:3545258-3545280 CCTCTCTGCATCTGTGTGTCCAG No data
Right 968925511 4:3545290-3545312 CGTGCCAGAAGTCCCCAGGCAGG No data
968925506_968925510 5 Left 968925506 4:3545258-3545280 CCTCTCTGCATCTGTGTGTCCAG No data
Right 968925510 4:3545286-3545308 CCTGCGTGCCAGAAGTCCCCAGG No data
968925506_968925514 19 Left 968925506 4:3545258-3545280 CCTCTCTGCATCTGTGTGTCCAG No data
Right 968925514 4:3545300-3545322 GTCCCCAGGCAGGAGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968925506 Original CRISPR CTGGACACACAGATGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr