ID: 968931272

View in Genome Browser
Species Human (GRCh38)
Location 4:3580818-3580840
Sequence TGATCACCAGATCACTGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 79}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968931272_968931280 21 Left 968931272 4:3580818-3580840 CCCCTACAGTGATCTGGTGATCA 0: 1
1: 0
2: 1
3: 9
4: 79
Right 968931280 4:3580862-3580884 GGGCTATGGTACCAATGGCCTGG 0: 2
1: 0
2: 0
3: 6
4: 63
968931272_968931276 0 Left 968931272 4:3580818-3580840 CCCCTACAGTGATCTGGTGATCA 0: 1
1: 0
2: 1
3: 9
4: 79
Right 968931276 4:3580841-3580863 TGAGCACAGTGGTTAGCATGTGG 0: 2
1: 0
2: 1
3: 31
4: 248
968931272_968931277 1 Left 968931272 4:3580818-3580840 CCCCTACAGTGATCTGGTGATCA 0: 1
1: 0
2: 1
3: 9
4: 79
Right 968931277 4:3580842-3580864 GAGCACAGTGGTTAGCATGTGGG 0: 2
1: 0
2: 2
3: 16
4: 175
968931272_968931278 7 Left 968931272 4:3580818-3580840 CCCCTACAGTGATCTGGTGATCA 0: 1
1: 0
2: 1
3: 9
4: 79
Right 968931278 4:3580848-3580870 AGTGGTTAGCATGTGGGCTATGG 0: 2
1: 0
2: 0
3: 11
4: 162
968931272_968931281 22 Left 968931272 4:3580818-3580840 CCCCTACAGTGATCTGGTGATCA 0: 1
1: 0
2: 1
3: 9
4: 79
Right 968931281 4:3580863-3580885 GGCTATGGTACCAATGGCCTGGG 0: 2
1: 0
2: 0
3: 13
4: 92
968931272_968931279 16 Left 968931272 4:3580818-3580840 CCCCTACAGTGATCTGGTGATCA 0: 1
1: 0
2: 1
3: 9
4: 79
Right 968931279 4:3580857-3580879 CATGTGGGCTATGGTACCAATGG 0: 2
1: 0
2: 0
3: 7
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968931272 Original CRISPR TGATCACCAGATCACTGTAG GGG (reversed) Intronic
902451949 1:16501754-16501776 TGCTCACCTGCTCACTGCAGAGG + Intergenic
902501006 1:16911910-16911932 TGCTCACCTGCTCACTGCAGAGG - Intronic
903210600 1:21816053-21816075 TGGTCACCAGCTGACTGCAGAGG + Exonic
909816761 1:80004172-80004194 TCATCATGAGATCATTGTAGGGG + Intergenic
916936496 1:169633321-169633343 TGTTCACTAGCTCACTATAGTGG - Intergenic
918143604 1:181737681-181737703 TGAGCACCAGAGCACTACAGAGG - Intronic
920563229 1:206954140-206954162 TGATCACCACATGCCTGTAGAGG + Intergenic
921609106 1:217190138-217190160 TTATCCCCAGTTCTCTGTAGGGG + Intergenic
922329519 1:224562030-224562052 TGATCACCATGTCACTGAAAAGG + Intronic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
1063170199 10:3502685-3502707 TAATCACCAGTTCCCTGTAGTGG - Intergenic
1063475973 10:6329451-6329473 TGCTCACCAGCTCAATGTAAGGG + Intergenic
1064198194 10:13262610-13262632 TGATCACAAAATGACTGCAGTGG - Intergenic
1065572735 10:27088607-27088629 TGAAAAACAGATCACTTTAGGGG + Intronic
1065946819 10:30612320-30612342 TGTTCACCAGAACACAGCAGCGG + Intronic
1072891815 10:99330602-99330624 CCTTCACCAGGTCACTGTAGGGG - Exonic
1075302462 10:121337558-121337580 TTATCACCAGCACACAGTAGAGG - Intergenic
1075471974 10:122697801-122697823 TCTTGACCAGATCACTGAAGTGG + Exonic
1081800436 11:45855237-45855259 TGATCACCAGAGCCCTGGAGAGG + Intronic
1091097923 11:132841400-132841422 TGATCTCTAGCCCACTGTAGAGG + Intronic
1093919331 12:24842124-24842146 GGACCATCAGATCACTGAAGTGG - Exonic
1102374532 12:112410905-112410927 TGATGATCAGATGATTGTAGTGG - Intronic
1104058195 12:125246114-125246136 GGATCACTGGATCACTGGAGAGG - Intronic
1118781807 14:69013636-69013658 TGAACACGAAATCACTCTAGGGG - Intergenic
1120195171 14:81473957-81473979 TCATCACCAGATCACTGGCAGGG + Exonic
1121015387 14:90545845-90545867 AGAACACCAGAGCACTGCAGAGG - Intronic
1129941457 15:79500686-79500708 TCATCACATGAGCACTGTAGTGG + Intergenic
1139932953 16:70544322-70544344 TGATCAGCAGATAATTGTATTGG + Intronic
1151832595 17:76563488-76563510 AGATCACAAAATCACTGTAGTGG - Intergenic
1158466000 18:57690328-57690350 TGAGCACCAGATCACACTTGGGG + Intronic
1158666866 18:59440193-59440215 TGATCACCACTTCTCTGTGGTGG - Intronic
1159341088 18:67134642-67134664 TGATGACCAGATGACTGGGGTGG - Intergenic
1163641046 19:18462225-18462247 TAATCACCTGATCACTCTGGTGG + Intronic
1163641053 19:18462311-18462333 AAATCACCTGATCACTCTAGTGG + Intronic
1167876368 19:52416878-52416900 ACATCACCACATCACTGTGGAGG + Exonic
926812676 2:16770452-16770474 TGAACACAACATCACTGTAAGGG + Intergenic
927657941 2:24967044-24967066 TGATCACTAGATACCTGTAAAGG + Intronic
927937418 2:27083557-27083579 TGAGCTCCAGACCACTGTGGAGG + Exonic
931662661 2:64582117-64582139 TGATCACCAGACAGCTGTTGGGG + Intronic
932508520 2:72261269-72261291 TGATCACGAGTTCCCTGGAGGGG - Intronic
938187507 2:129244661-129244683 TGCTCACCAAATCAGTGTGGAGG - Intergenic
945487176 2:210410141-210410163 TGATCAGCAGATCTCAATAGTGG + Intergenic
1179841682 21:44080045-44080067 TGACCACCACCTCACTGAAGAGG + Exonic
1184804425 22:46783689-46783711 TCATCAACAGAACACTGAAGAGG - Intronic
954153694 3:48673057-48673079 TGATTACCAGATCTCTGCTGAGG + Intergenic
954715597 3:52525205-52525227 TCACCGCCAGATCACTATAGAGG + Exonic
955746509 3:62146047-62146069 TGGCCACCAGAACCCTGTAGGGG + Intronic
958463533 3:94428896-94428918 TGAACACAAGATCACCTTAGAGG - Intergenic
963627844 3:147695486-147695508 TAATCATGAGATCCCTGTAGAGG - Intergenic
964106163 3:153042295-153042317 TGGTCACAAGATGACTGTAGTGG + Intergenic
966206026 3:177407448-177407470 TGAGCTCCAGATCACTGTCTAGG + Intergenic
968931272 4:3580818-3580840 TGATCACCAGATCACTGTAGGGG - Intronic
976647637 4:87402097-87402119 TGATCACCACAACACTGCTGTGG - Intergenic
978389361 4:108208273-108208295 GGATCAACAGACCACTGGAGTGG - Intergenic
981646041 4:146999823-146999845 TGATGACCAGGTAAATGTAGAGG + Intergenic
986195993 5:5536770-5536792 TACTCACCAGACCACTGTGGGGG + Intergenic
989140204 5:38194418-38194440 TGATCACAAGAACACCGTGGAGG + Intergenic
989391863 5:40908882-40908904 TGATAATCAGATCACTGTGTTGG - Intergenic
995733805 5:115275353-115275375 TGATCACCAGAACTTTGTAAAGG - Exonic
998924760 5:147110352-147110374 TGATCAGCAGACTACTGGAGAGG + Intergenic
1004316635 6:14593785-14593807 TCACCACCAGGTCAGTGTAGAGG - Intergenic
1004662127 6:17719915-17719937 TGCTAACCAGATCAGTGTACTGG + Intergenic
1007690640 6:43699080-43699102 TGGTCCCCAGATCTCTGTCGGGG + Intergenic
1008493335 6:52108261-52108283 TGATCCCCAGCTCACTGTCCTGG + Intergenic
1009340484 6:62548147-62548169 GGATCAGCAGATCACTGAAGTGG + Intergenic
1014960422 6:127676929-127676951 TGAAGATCAGATGACTGTAGGGG + Intergenic
1017814765 6:158008860-158008882 TGATCCCCAGACCCCTGCAGTGG + Intronic
1022354434 7:29599265-29599287 TGAACACCAGAGCTCTGCAGAGG - Intergenic
1024602874 7:51000290-51000312 TGAAAACCAGAGCTCTGTAGAGG - Intergenic
1028492151 7:91424497-91424519 TGTTTACCAGATCTCTCTAGGGG - Intergenic
1036758849 8:11492792-11492814 TGATAAGCAGATCACTGCAGTGG - Intergenic
1038080889 8:24134854-24134876 TGATCACAAAATCAATTTAGTGG - Intergenic
1042872693 8:73412603-73412625 TGATCACCAAATGGCTGTGGGGG - Intergenic
1043280060 8:78452718-78452740 TTATTTCCAGATCACTCTAGAGG + Intergenic
1043861688 8:85324628-85324650 TGTTCACCAGTTCACTGTTTTGG + Intergenic
1050716058 9:8527214-8527236 TAGACACCAGATCTCTGTAGTGG - Intronic
1052018047 9:23492311-23492333 TGATCATCAGCTCCCTCTAGAGG + Intergenic
1054458853 9:65451113-65451135 TGATCGTCAGATCACTGTAGGGG + Intergenic
1055012129 9:71578643-71578665 TGAAAACCAGATCACAGTAGTGG - Intergenic
1056623969 9:88238503-88238525 TCATCACCAGACCACTGTGAGGG + Intergenic
1057000143 9:91501120-91501142 TGATCAGCAAATCACTGTGAGGG + Intergenic
1057887442 9:98840624-98840646 TGATCAACACATCACAGCAGAGG - Intronic
1058287979 9:103204341-103204363 AGATCACAAAATCACTGTAGTGG + Intergenic
1185430870 X:11028-11050 TGATGACCAGACCACTAGAGAGG - Intergenic
1185440136 X:223425-223447 TGATGACCAGACCACTAGAGAGG - Intergenic
1187731867 X:22263812-22263834 TGGCTACCAGAGCACTGTAGTGG - Intergenic
1191829578 X:65401885-65401907 TTATCACCTGATAACTGAAGAGG + Intronic
1195433855 X:104819622-104819644 TGATCAGCACATCCCTGGAGAGG + Intronic
1198315920 X:135466083-135466105 TGAAAACGAGTTCACTGTAGGGG - Intergenic
1198393147 X:136196524-136196546 AGATCAGCAGATTACTGTACAGG - Intronic