ID: 968931827

View in Genome Browser
Species Human (GRCh38)
Location 4:3584510-3584532
Sequence AAATCAGCTGACCTTCAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 2, 1: 0, 2: 5, 3: 54, 4: 343}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968931826_968931827 11 Left 968931826 4:3584476-3584498 CCGTGAGGCTGCTTTTCGGATAA 0: 1
1: 0
2: 0
3: 4
4: 105
Right 968931827 4:3584510-3584532 AAATCAGCTGACCTTCAGTTAGG 0: 2
1: 0
2: 5
3: 54
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968931827 Original CRISPR AAATCAGCTGACCTTCAGTT AGG Intronic
900890938 1:5449252-5449274 TCATCAGCTGACCTTGAGCTGGG + Intergenic
901115583 1:6841246-6841268 TAATCAGCTGACCTTAAAATAGG - Intronic
901152189 1:7111212-7111234 TAATCAGCTGATCTTGAGATGGG - Intronic
903489809 1:23719723-23719745 TAATCAGCTGACCTCAAGATAGG - Intergenic
904228418 1:29044918-29044940 AAATCAGGTGACCATAAATTTGG + Intronic
907512924 1:54975758-54975780 TAATCAGCAGACCTTAAGGTAGG + Intergenic
908808319 1:67953736-67953758 TAACCAGCTGACCTTAAGATAGG - Intergenic
909381345 1:75002429-75002451 TAATCAGCTGACCTTAACATAGG - Intergenic
910070020 1:83201624-83201646 AAACCAGCTGACCTTAAGATAGG - Intergenic
910412353 1:86960353-86960375 AAATCTGGTGACCTTAGGTTTGG + Intronic
912959108 1:114179564-114179586 TGATCAGCTGATCTTCAGATCGG + Intergenic
914331334 1:146673370-146673392 AAATCAGCTGACTTTCAGATAGG - Intergenic
915635509 1:157183822-157183844 TAATCAGCTGACCTTAAAATAGG - Intergenic
915662153 1:157413524-157413546 TAATCAGCTGACCTTAAAATAGG - Intergenic
917912556 1:179665535-179665557 AAATCAGCTGACATAAAGATAGG + Intronic
919449076 1:197748478-197748500 CAATCAGCTGACCTTAAAATAGG + Intronic
920410890 1:205760000-205760022 TAATCAGCTGATCTTGAGGTGGG + Intergenic
921266812 1:213427786-213427808 AAATCAGCTTACCTTGTGATCGG + Intergenic
922355536 1:224771813-224771835 TAATCAGCTGACCGTGAGGTGGG + Intergenic
923526159 1:234774449-234774471 AAATCAGCTGACCTTACAGTGGG - Intergenic
924811344 1:247405209-247405231 TAATCAGCTGACCTGAAGGTAGG - Intergenic
1063133580 10:3198201-3198223 GAATCAGCTGAGCTTCAGACTGG - Intergenic
1063398586 10:5718251-5718273 AAATCAGTTTCCCTTCTGTTTGG - Intronic
1064627505 10:17276088-17276110 TAATCAGATGACCTTGAGATGGG - Intergenic
1065161831 10:22929992-22930014 AAATCATCTGATTTTCACTTAGG - Intronic
1065610013 10:27463597-27463619 GAAGCAGCTCACCTTCTGTTGGG - Intergenic
1066011704 10:31200507-31200529 TAATCAGCTGACCTTAAGTAAGG + Intergenic
1068336023 10:55633160-55633182 CAATCAGCTGACCTTAAAATAGG + Intergenic
1069028643 10:63571596-63571618 TAATCAGCTGACCTTGAAATGGG - Intronic
1069378686 10:67820040-67820062 GTCTCAGCTGACCATCAGTTGGG - Intronic
1069781291 10:70957420-70957442 TAATCAGCTGACCTTCAAGTAGG + Intergenic
1070409372 10:76125364-76125386 AAATGAGGTGACCTCCTGTTCGG + Intronic
1070555555 10:77525025-77525047 AAATGAGCTCACTTTCAGTAAGG + Intronic
1072444896 10:95490533-95490555 AATTCAACTGACCACCAGTTAGG - Intronic
1073808849 10:107130669-107130691 AAATCTGTTCACCTTCAGGTAGG - Intronic
1078062546 11:8057304-8057326 TAAGCAGCTGACCCTCGGTTTGG - Intronic
1078457727 11:11488454-11488476 TAATCAGCTGACCTTGAGTTGGG - Intronic
1078508857 11:11970592-11970614 TAATCAGCTGACCTGAAGGTAGG + Intronic
1080769859 11:35330586-35330608 TAATCAGCTGACCTCAAGATAGG + Intronic
1081331138 11:41801586-41801608 AAGCCAGGTGCCCTTCAGTTGGG - Intergenic
1081602551 11:44505348-44505370 TAATCAGCTGACCTTGAGTTGGG + Intergenic
1082271456 11:50174125-50174147 AAATCAACTGAGCTTCAGAAGGG - Intergenic
1082929830 11:58590879-58590901 ATATCAAATGCCCTTCAGTTAGG - Intronic
1083131973 11:60633322-60633344 AAATAAGCTCTCCTTGAGTTTGG - Intergenic
1084364182 11:68686739-68686761 AAATCAGCCGACCCTCAGGCAGG - Intronic
1084580926 11:70022823-70022845 TAATCAGCTGACCTTGAGGCAGG + Intergenic
1084643537 11:70440547-70440569 TAATCAGCTGGCCTTCAAATTGG + Intergenic
1084840010 11:71838872-71838894 TAATCAGCTGACCTTAAAATAGG - Intergenic
1085446082 11:76601954-76601976 AAATCAACTGACTTTAAGTAAGG - Intergenic
1085805499 11:79632233-79632255 AGATAAGCAGATCTTCAGTTTGG + Intergenic
1085858761 11:80207199-80207221 AAAACAGCTGACCTTCAATGAGG - Intergenic
1086565084 11:88216619-88216641 AAGTCAGTTGACCTTCTGTTTGG + Intergenic
1087711331 11:101556297-101556319 AAATCAACAAACCTTTAGTTGGG + Intronic
1087921321 11:103870004-103870026 TTATCAGTTGACTTTCAGTTAGG + Intergenic
1088018684 11:105092017-105092039 ATATCAGCTGACCCTCAGAAAGG + Intronic
1088021241 11:105122205-105122227 ATATCAGCTGACCCTCAGAAAGG + Intergenic
1088332658 11:108669692-108669714 TAATCAGCTGACCTTAAAGTAGG + Intronic
1088963480 11:114694202-114694224 TAATTAGCTGACCTTGAGATGGG - Intronic
1090165844 11:124546057-124546079 AACTCACCTGACCTTCATTTTGG + Intergenic
1091834823 12:3578310-3578332 AAATCACCTGAGCCTCAGTGAGG - Intronic
1092460776 12:8684153-8684175 AATTTAGATGACCTTCAGTATGG - Intronic
1094013621 12:25836997-25837019 AAATCAGCTTCCATTCAATTGGG + Intergenic
1094178124 12:27563066-27563088 TAATCAGCTGACCTTAGGTTGGG + Intronic
1095152272 12:38809458-38809480 TAATTAGCTGACCTTAAGATAGG - Intronic
1097677564 12:62619448-62619470 TAATTAGCTGACCTTAAGATAGG + Intergenic
1099833275 12:87873274-87873296 TAATCAGCTGACCTTAAAATGGG - Intergenic
1100134739 12:91541696-91541718 AAATCAGTTGACCTTAAAATAGG - Intergenic
1100959638 12:99948035-99948057 TAATCAGTTGACCTTAAGGTAGG - Intronic
1101063890 12:100999475-100999497 TAATCAGCTGACCTTAAGACAGG - Intronic
1101822600 12:108195597-108195619 AAAGAAGCTCACCTTCAGTTTGG + Exonic
1102609409 12:114098238-114098260 AGTTCAGCTGCCCTTGAGTTTGG + Intergenic
1102963265 12:117107459-117107481 TAATCAGCTGACCCTGAGATGGG + Intergenic
1103951373 12:124553274-124553296 TAACCAGCTGACCTTGAGATGGG - Intronic
1104165862 12:126229183-126229205 AAACCAGCTGAGCTTCAGCCAGG + Intergenic
1104166858 12:126240031-126240053 TAATCAGCTGACATTGAGATGGG - Intergenic
1104590274 12:130079144-130079166 AAACCAGTTGAGCTTCTGTTGGG + Intergenic
1105613890 13:21994940-21994962 TAATCAGCTGACCTTAGGATAGG + Intergenic
1106367812 13:29100272-29100294 GAATCATCTAACCTTCTGTTGGG - Intronic
1106891022 13:34245606-34245628 TAATCAGCTGACCTTAAGGTAGG - Intergenic
1106904539 13:34391377-34391399 ACATAAGCTGACCTTCAATATGG + Intergenic
1107242248 13:38250400-38250422 TAAACATCTCACCTTCAGTTGGG - Intergenic
1107700512 13:43042551-43042573 GAATCTGCTGGCTTTCAGTTTGG - Intronic
1110141808 13:72139564-72139586 AAATTAGCTGATTTTCAGTTTGG + Intergenic
1110721567 13:78768107-78768129 AAATAGGCTGACCTTCAGTGTGG + Intergenic
1111979104 13:94998279-94998301 AAATCAGTTGGCCTTAAGATGGG - Intergenic
1112286211 13:98106802-98106824 GATTCAGCTGAACTTCAGGTTGG + Intergenic
1112463370 13:99622204-99622226 TAATCAGCTGACCCTGAGTTGGG - Intronic
1112845609 13:103639053-103639075 AAATCAGTTGACCTTAAAATTGG - Intergenic
1114222315 14:20707810-20707832 TGATCAGCTGACCCTTAGTTTGG - Intergenic
1115728944 14:36247307-36247329 AAATCAGCTGTGAATCAGTTTGG - Intergenic
1116218109 14:42046599-42046621 AAATTAGATGACCTTCTGTTTGG - Intergenic
1116704315 14:48277325-48277347 TAATCAGCTGACTTTAAGATAGG - Intergenic
1116908914 14:50436491-50436513 ACATCAGATGACCTTTAGTGGGG + Intronic
1116908929 14:50436600-50436622 ACATCAGATGACCTTTAGTGGGG + Intronic
1117467666 14:56009575-56009597 TAATCAGCTGACCTCGAGATGGG - Intergenic
1118255839 14:64205116-64205138 TAATCAGCTGACCTTGAAATAGG - Intronic
1118426056 14:65663914-65663936 GAAACATCTGACCTTTAGTTTGG - Intronic
1119179571 14:72596383-72596405 AAATCAGCTGACTTTAAGATAGG - Intergenic
1119654483 14:76407455-76407477 AAATCCTCTGACCTTGACTTTGG + Exonic
1120589559 14:86359398-86359420 AAGTCAGTGGACTTTCAGTTTGG - Intergenic
1121182478 14:91939838-91939860 TAAGCAGCTGACCTTGAGATGGG + Intronic
1122378864 14:101287378-101287400 TAATCAGCTGACCTTAAAATAGG + Intergenic
1125287522 15:38109996-38110018 AAATCAGTTGACTTTAAGATAGG + Intergenic
1126371700 15:47953917-47953939 TAATCAGCTGACCTTAAAATAGG - Intergenic
1127362311 15:58255192-58255214 TAATCAGCTGACTTCCAGATAGG + Intronic
1127485669 15:59415436-59415458 TAATCAGCTGATCTTGAGATGGG + Intronic
1128268184 15:66285538-66285560 AAATCAGCTGACCTGAACATAGG + Intergenic
1129292154 15:74576683-74576705 AAATCATCTTACCTCCAGTCAGG + Intronic
1129802308 15:78424406-78424428 TAATCAGCTGACTTTGAGATTGG + Intergenic
1131265270 15:90911898-90911920 AAATCAGATCACCTCCACTTTGG + Intronic
1131399077 15:92110207-92110229 AAATCAGCTGAACTCCAGGATGG - Intronic
1132111229 15:99103587-99103609 AAACCAGCTGACCCTTGGTTGGG - Intronic
1133120383 16:3603019-3603041 AAAACAGCACACCTTCATTTTGG + Intronic
1133327207 16:4949042-4949064 ACCTGAGCTGACCTTCAGGTGGG + Intronic
1133659107 16:7897540-7897562 TAATCAGCTGGCCTTGAGATGGG - Intergenic
1134056026 16:11170390-11170412 AAACCAGCTGATGCTCAGTTGGG + Intronic
1134086387 16:11360211-11360233 AAGTCACCTGACCTTAAGGTAGG - Intronic
1134341185 16:13347940-13347962 TAATCAGCTGACCTTAAAATAGG + Intergenic
1134875998 16:17699245-17699267 AACTCAGATGTCCTTCAGTGGGG - Intergenic
1135141507 16:19926172-19926194 TAATCAGCTGACCTTGAGGTGGG - Intergenic
1137006455 16:35278976-35278998 TAATCAGATGACCTGCACTTGGG - Intergenic
1137692525 16:50439017-50439039 AAATCTGATGACCTTGGGTTTGG + Intergenic
1137855611 16:51791582-51791604 AAGTCAGCTGACCTTGAGGTGGG + Intergenic
1139345811 16:66302953-66302975 TAATCAGCTGATCTCCAGATGGG + Intergenic
1140002222 16:71037531-71037553 AAATCAGCTGACTTTCAGATAGG + Intronic
1140802027 16:78497112-78497134 ACAACAGATGACCTTCTGTTAGG + Intronic
1140927970 16:79600897-79600919 CAATCAGCTGACTGTCAGCTGGG + Intergenic
1141002070 16:80317617-80317639 CAATCCGCTGACCCTCACTTAGG + Intergenic
1141645319 16:85364356-85364378 TAACCAGCTGACCTTGAGATGGG - Intergenic
1143262724 17:5612082-5612104 TAATCATCTGACCTTCAGAAAGG + Intronic
1143365292 17:6404337-6404359 TAATCAGCTGACCTTAAGGTAGG - Intronic
1144052580 17:11509625-11509647 AACTCAAAAGACCTTCAGTTAGG - Intronic
1146747981 17:35348867-35348889 AAATAAAATGTCCTTCAGTTTGG - Intergenic
1148982650 17:51592078-51592100 CAATCAGCTGACCTTGAATGGGG + Intergenic
1149720404 17:58838116-58838138 AAATCTAGTGACCTTGAGTTTGG + Intronic
1151142727 17:72010473-72010495 TAATCAGCTGACCTTAAAGTAGG + Intergenic
1151864608 17:76792694-76792716 TAATCAGCTCACCTTGAGATGGG + Intergenic
1152056146 17:78028428-78028450 AAATCATGTGACATGCAGTTTGG - Intronic
1152370287 17:79883623-79883645 AAATGTTCTGACCTTGAGTTTGG - Intergenic
1153225806 18:2898796-2898818 AACTCAGCTGATTTTGAGTTGGG - Intronic
1153809978 18:8743774-8743796 TAATCAGCTGACCTTGAAATAGG - Intronic
1155161381 18:23198541-23198563 AAATAAGCTGACCTTTAAATGGG + Intronic
1155397031 18:25397564-25397586 AAATCAGCTGTCTGTAAGTTAGG - Intergenic
1155571662 18:27201270-27201292 AAATCCATTGACCTTCAGATAGG - Intergenic
1156289626 18:35734935-35734957 TAATCACCTGACCTTCAGATGGG + Intergenic
1157225052 18:45855179-45855201 AAATTAGCTGAGCTTTAGCTTGG - Intronic
1157678782 18:49587592-49587614 AAAGAAGCTGACCTTCTGCTAGG + Intronic
1158835438 18:61326696-61326718 TAATCAGCTGACATTCAAATAGG - Intergenic
1159299954 18:66550497-66550519 TAATTAGCTGACCTTGAGATGGG + Intronic
1159834069 18:73314890-73314912 AAATCAGTTGACCTTAAGAAGGG - Intergenic
1160360770 18:78275519-78275541 AAAACAGATGACCTTGGGTTTGG - Intergenic
1162085110 19:8243998-8244020 TAATCAGCTGAGCTTGAGATGGG + Intronic
1165398916 19:35585206-35585228 AAATCAGTTAACTTTAAGTTAGG - Intergenic
1165593954 19:36995992-36996014 AAATCTGCTCAACTTCAATTAGG + Intronic
1167625867 19:50588791-50588813 TAATCAGCTGACGTTAAGATAGG + Intergenic
1168010524 19:53527424-53527446 TAATCAGCTAACCTTAAGATAGG + Intronic
1168013064 19:53549234-53549256 AGATCAGTTGACCATGAGTTTGG + Intronic
1168690532 19:58373975-58373997 CAATCAGCTCACCTGCAGTGGGG - Intronic
925097411 2:1218251-1218273 AACTCAGCTGACCTTGAGTTAGG - Intronic
925486742 2:4342898-4342920 TAATCAGGTAACCTTCAGGTAGG + Intergenic
925994898 2:9284086-9284108 TAATCAGCTGAACTTGAGATGGG - Intronic
926302960 2:11617586-11617608 AGAGCAGCTGACCCTCAGTCGGG + Intronic
926427454 2:12752071-12752093 TAATCAGCTGACCTTAAAATAGG - Intergenic
926842354 2:17095823-17095845 AAATCTTCTGACCTTAAGTAAGG + Intergenic
928318456 2:30264252-30264274 CAATCAGCTGACCTTGGCTTGGG + Intronic
929358951 2:41060035-41060057 TAATCAGCTGACTTTTAGGTGGG + Intergenic
929739202 2:44585342-44585364 AATTCAGCTGAACTTCAGAAAGG + Intronic
930725991 2:54681842-54681864 TAATCAGCTGACCTTAAAATAGG - Intergenic
931078252 2:58740744-58740766 AAATCAGCTGACATTTACATAGG - Intergenic
932390153 2:71381960-71381982 AAAACAGCTGGGCTTCACTTTGG + Intronic
932506647 2:72239257-72239279 AAATCTTCTGACCTTGAGTTAGG - Intronic
932831148 2:74991429-74991451 TAATCAGCTGACCTTAAAATAGG + Intergenic
932981559 2:76674776-76674798 AAATTAGCTGTATTTCAGTTTGG + Intergenic
934016674 2:87893739-87893761 AAATCAGTTGATCTTAAGATAGG + Intergenic
934579267 2:95425584-95425606 AAATGACCTGACCTTGAGTATGG + Intergenic
934600179 2:95651140-95651162 AAATGACCTGACCTTGAGTATGG - Intergenic
934995903 2:98959955-98959977 TAATTAGCTGCCCTTCAGCTAGG + Intergenic
935648911 2:105365490-105365512 AACTCAGATGAACTTCCGTTAGG + Intronic
935803257 2:106720539-106720561 GAATCAGGTGACCTTGAGTTTGG - Intergenic
935999906 2:108817119-108817141 TAATCAGCTGACCTTAAAATAGG + Intronic
936941997 2:117893252-117893274 AAATTAGATGACCTTGGGTTTGG - Intergenic
937269132 2:120636667-120636689 TAATCAGGTGACCTTGAGATGGG + Intergenic
937711051 2:124980270-124980292 AAATCAGCTCCACTTCAGGTTGG + Intergenic
937811370 2:126203213-126203235 TAATCAGTTGACTTTCAGTAAGG - Intergenic
938152266 2:128897566-128897588 AAATCAGCTGACTTTAAGAGAGG - Intergenic
939021393 2:136961991-136962013 TAATCAGCTGACCCTGAGATGGG + Intronic
939194007 2:138949947-138949969 TAATCAGCTGACTTTTAATTGGG - Intergenic
939422804 2:141995483-141995505 CAATCAGCTGACCTTAAAATAGG - Intronic
939732172 2:145798293-145798315 TAATCTGCTGACCTTAAGATAGG + Intergenic
940631172 2:156241138-156241160 AAATCAGTTGACCTTGAGATAGG - Intergenic
941923479 2:170873962-170873984 CAATCAGTTGACCTTCAGATAGG + Intergenic
944001482 2:194843327-194843349 AAATCAGCTGCCATTCAAATTGG - Intergenic
944505337 2:200404992-200405014 TAATTAGCTGACCTTCAAATGGG - Intronic
944908725 2:204288284-204288306 TAATCAGCTGACCTCAAGATAGG + Intergenic
945354906 2:208828992-208829014 ACATAAACTGACTTTCAGTTAGG - Intronic
947142064 2:227028520-227028542 AAAGCAACTAAACTTCAGTTGGG - Intronic
1168790797 20:574570-574592 GACTCAGGTGACCTTCAGGTTGG + Intergenic
1169677851 20:8174673-8174695 AAATCATCTTACTTTCATTTAGG - Intronic
1169752900 20:9013058-9013080 AAGTAAGCTGACTTTCAGGTAGG - Intergenic
1170163605 20:13341034-13341056 AAATCTGCAGACCTACAGCTTGG + Intergenic
1170243238 20:14193318-14193340 AAAGCAGCTAATTTTCAGTTAGG - Intronic
1172856554 20:38008532-38008554 TAATCAGCTAACCAGCAGTTGGG + Intronic
1174065141 20:47859058-47859080 TAGTCAGCTGACCTTCAAATAGG - Intergenic
1177006965 21:15685740-15685762 TAATCAGCTGACCTTAAACTAGG - Intergenic
1178234056 21:30821593-30821615 CAATCTGCTGACCTTAAGTTAGG + Intergenic
1178287066 21:31334706-31334728 AACTCTGCTGAGCATCAGTTCGG + Intronic
1179034441 21:37747543-37747565 TAATCAGCTGACCTTCAACTGGG + Intronic
1179140052 21:38717451-38717473 TAATCATCTGACCTTCTGATAGG + Intergenic
1179252615 21:39685125-39685147 TAATCATCTGACCTTGAGATGGG - Intergenic
1182110842 22:27722160-27722182 AATTCTGCTGATCTGCAGTTGGG + Intergenic
1182879520 22:33721612-33721634 TTATAAGCTGCCCTTCAGTTGGG - Intronic
1183430748 22:37764132-37764154 TAATCAGCTGACCTTAAAATCGG - Intronic
1184307333 22:43614546-43614568 AATTTAGATGACCTTGAGTTTGG + Intronic
1203293773 22_KI270736v1_random:20914-20936 AAAAGAGCAGACATTCAGTTTGG + Intergenic
951246606 3:20348762-20348784 AAGTCACCTGACCTTAAATTAGG - Intergenic
951557225 3:23932989-23933011 AAATCAGCTGACTTTGAGATGGG + Intronic
953022469 3:39124214-39124236 AAATTAGATGTCCTTCAGTAGGG + Intronic
955251828 3:57290459-57290481 TAATCAGCTGACTTTTAGATAGG - Intronic
955536398 3:59928304-59928326 TAAGCAGCTGACCTTAAGATTGG + Intronic
955848536 3:63194558-63194580 AAATCAGTTTGCCTTGAGTTAGG + Intergenic
956389764 3:68759048-68759070 AAGACTGCTGACCTTCAGATGGG - Intronic
957312367 3:78537433-78537455 TAATCAGCTGACCTTGAGATAGG + Intergenic
959087667 3:101868611-101868633 TAACCAGCTGACCTTAAGATAGG + Intergenic
959568305 3:107855522-107855544 GAATCAGCAGACCTTCACTCTGG - Intergenic
960367438 3:116789998-116790020 ATATCAGTTGCCATTCAGTTCGG - Intronic
960875112 3:122288072-122288094 TAATCAGCTGACCTTGAGATAGG + Intergenic
960876256 3:122298028-122298050 TAATCAGATGACCTTGAGATAGG + Intergenic
961542635 3:127610403-127610425 AAATCAGCTAACCTGCAGCCTGG - Intronic
963538703 3:146560473-146560495 AAATCAGTTGACCTTAAGATGGG - Intergenic
964976929 3:162633309-162633331 AAAACAGTTGACCTTCAGATAGG - Intergenic
965636556 3:170788089-170788111 TAATCAGCTGACCTTAAATTAGG + Intronic
965982435 3:174710167-174710189 AAATCAGTTGACCTTAAAATAGG + Intronic
967715213 3:192754515-192754537 ACATCAGCTGTATTTCAGTTTGG - Intronic
967851372 3:194085082-194085104 TAATCAGCTGACCTCGAGATGGG - Intergenic
968604082 4:1523397-1523419 AAGTCAGCTGATATTCAGTGTGG + Intergenic
968931827 4:3584510-3584532 AAATCAGCTGACCTTCAGTTAGG + Intronic
969781101 4:9404872-9404894 TAATCAGCTGACCTTAAAATAGG - Intergenic
969923840 4:10566419-10566441 TAATCAGCTGACCTTAAAATAGG + Intronic
970141123 4:12983261-12983283 TAATCTGCTGACCTTGAGATAGG - Intergenic
970274651 4:14385419-14385441 TAATCAGTTGACCTTGAGATGGG + Intergenic
971752371 4:30666853-30666875 TAATCAGCTGACCTTAAAATAGG - Intergenic
971878202 4:32331316-32331338 TAATCAGCTGACCTTAAAATGGG - Intergenic
971985966 4:33824461-33824483 AAATCAGCTGCATTTCACTTTGG + Intergenic
973845344 4:54906749-54906771 AAATCAGCTGGGATTCAGATAGG - Intergenic
975600378 4:76093573-76093595 TAATTAGCTGGCCTTCAGGTGGG - Intronic
975645545 4:76542431-76542453 TAATCAGCTGACCTCTAGATTGG + Intronic
975740949 4:77428367-77428389 TAATCAGTTGACTTTAAGTTAGG + Intronic
975822662 4:78287582-78287604 ATATCAGCTGCCCCTCAGATTGG - Intronic
976106695 4:81626969-81626991 AAATCAGTTGACTTTAAGATAGG + Intronic
977481726 4:97586608-97586630 AAATCTGCTGGCCTTCAAATTGG - Intronic
977849616 4:101809962-101809984 TAATCAGCTGACTTTGAGATAGG + Intronic
980082755 4:128361928-128361950 TAATCAGCTGACCTTGAGATTGG + Intergenic
980130805 4:128813738-128813760 AAATCAGATGACTTTCTGCTTGG + Intronic
981356467 4:143794961-143794983 TAATCAGCTGACCTTGAGAAGGG - Intergenic
981367999 4:143925555-143925577 TAATCAGCTGACCTTGAGAAGGG - Intergenic
981377793 4:144035834-144035856 TAATCAGCTGACCTTGAGAAGGG - Intergenic
981823584 4:148914288-148914310 AATTCAGCAGTCTTTCAGTTGGG + Intergenic
982323051 4:154100339-154100361 AAATCAGTTGACCATAGGTTGGG + Intergenic
982554881 4:156847923-156847945 AAGTCAGCTGACTTGCAGATCGG - Intronic
983476415 4:168217609-168217631 GAATCAGCTGACCTTGAGATAGG + Intronic
983720550 4:170846448-170846470 TAATCAGCTGACCTTAAAATAGG - Intergenic
983756672 4:171347089-171347111 TAATCAGCTGACCTTAAAATAGG - Intergenic
985261686 4:188120313-188120335 AAATCAATTGACCTTAAGGTAGG + Intergenic
986048548 5:4064918-4064940 AAATCATCACACCTTCAGATGGG - Intergenic
986351078 5:6879914-6879936 TAATCAGTTGACCTTGAGATGGG - Intergenic
986777894 5:11035509-11035531 TAATCAGCTAACCTTGAGATAGG - Intronic
986788129 5:11134006-11134028 TAATCAGCTGACCTTAGGATAGG + Intronic
989080456 5:37614372-37614394 TAATCAGCTGACCTTAAAATAGG - Intronic
989620144 5:43376087-43376109 AAATCAGTTGACCTTAAGATAGG - Intergenic
989734508 5:44687823-44687845 AAGTCAGCTGACCTTCAAAATGG + Intergenic
989836745 5:46002900-46002922 AAATCAGTTTTCCTTCAATTGGG + Intergenic
990018886 5:51101076-51101098 AAATCAGCTTACCTGAACTTGGG + Intergenic
991598731 5:68331371-68331393 AAATCAGCTGACCTTAAAAGAGG + Intergenic
991929195 5:71735328-71735350 TAATCAGCTGACCTTAAGATAGG - Intergenic
992647847 5:78828841-78828863 TAATCAGCTGACTTTCAAATAGG + Intronic
992885343 5:81153277-81153299 AAATCAGCTGATCGTCAGATAGG + Intronic
992960319 5:81951552-81951574 AAACAAGCTGACCTTCCCTTAGG - Intergenic
993080166 5:83286633-83286655 CAATCAGTTGACTTTCAGTAAGG - Intronic
995958493 5:117810343-117810365 TAATCAGCTGACCTTAAAATAGG + Intergenic
996368535 5:122728330-122728352 TAATCAGCTGACCTTGAAGTAGG + Intergenic
997822095 5:137075439-137075461 TAAAGAGCTGACCTTCAGTAAGG + Intronic
998878673 5:146625790-146625812 TAATCAGCTGACCTTAAGGTGGG + Intronic
999056200 5:148579928-148579950 AAATCAGCTGACCTTAAAATAGG - Intronic
999183267 5:149685620-149685642 CACTCAGCTGACCTTAAGTGGGG - Intergenic
1000895180 5:166846623-166846645 TAATCAGCTGACCTTAAAATAGG - Intergenic
1000949254 5:167460759-167460781 AAATCAACTGAATTTCAGTTGGG + Intronic
1001801851 5:174551365-174551387 AAATCAACTGACATTTAATTTGG + Intergenic
1002072728 5:176689938-176689960 TCATGAGCTGACCTTGAGTTGGG - Intergenic
1002824056 6:756774-756796 TAATCAGCCGACCTTAAGGTAGG + Intergenic
1003410872 6:5862011-5862033 TAATCAGCTGACTTTGAGATAGG + Intergenic
1004255748 6:14062409-14062431 AAACCAGCTGACCTTGATCTTGG + Intergenic
1004459587 6:15823212-15823234 TAATCAGATGACCTTGAGATGGG - Intergenic
1005275387 6:24211511-24211533 TAAGCAGCTGACCTTGAGATGGG + Intronic
1006206724 6:32350706-32350728 TAATCAGCTGACCTTAAAATAGG + Intronic
1006532033 6:34663869-34663891 TAATCAGCTGACCTTAAAATAGG + Intronic
1006944582 6:37776998-37777020 TAATCAGCAGACCTTGAGGTAGG - Intergenic
1008323452 6:50147294-50147316 AGAACTGCTGACCTTCAATTTGG - Intergenic
1009502504 6:64432956-64432978 AAATCAGGTGAAATACAGTTTGG - Intronic
1009556265 6:65172300-65172322 ATATCAGCTGACTTTCAAGTAGG - Intronic
1009682000 6:66907101-66907123 TAATCAGCTGACCTTACGATAGG + Intergenic
1013597077 6:111669966-111669988 AAAGCAGATGATGTTCAGTTGGG + Intronic
1013814922 6:114086214-114086236 TAATCAGCTGAACTTAAGATAGG + Intronic
1013995064 6:116298317-116298339 TCATCAGCTGACCTTGAGATAGG + Intronic
1015020628 6:128469717-128469739 TAATCAGCTGACGTTGAGATGGG + Intronic
1015971713 6:138749083-138749105 TAATCAGCTGATCTTAAGGTAGG - Intergenic
1016430888 6:143984111-143984133 AAAACAGCTGACTTGGAGTTAGG - Intronic
1016504174 6:144759587-144759609 AAATCAACTGACCTTTAATTAGG + Intronic
1016593651 6:145774069-145774091 AAATCAACTGACCTTAAGATAGG - Intergenic
1016845040 6:148561336-148561358 AAATCAGTTGACTTTAAGTAAGG - Intergenic
1018589313 6:165400021-165400043 AAATCAGCTGACCGTCTGTGTGG - Intronic
1019696179 7:2447296-2447318 ACATCAGCAAACCTTCTGTTCGG + Intergenic
1020875041 7:13683072-13683094 AAATCAGTTGATCTTAAGGTAGG - Intergenic
1022861108 7:34367917-34367939 AAATCAGTTGACATTAAGTGAGG - Intergenic
1023109186 7:36792964-36792986 TAATCGGCTGACCTTAAGGTAGG + Intergenic
1024011332 7:45269415-45269437 AAGCCTGCTGACCTTCAGATTGG + Intergenic
1024062133 7:45706624-45706646 AATCTAGATGACCTTCAGTTTGG + Intronic
1026260279 7:68748893-68748915 TAATCAGCTGACCTTGAAATAGG + Intergenic
1026761509 7:73130205-73130227 AAACCAGCTGACCCTGAGGTGGG + Intergenic
1027037850 7:74939016-74939038 AAACCAGCTGACCCTGAGGTGGG + Intergenic
1027085712 7:75262455-75262477 AAACCAGCTGACCCTGAGGTGGG - Intergenic
1027287793 7:76666783-76666805 AAACCAGCTGACCTTAAGATAGG - Intergenic
1027527339 7:79286724-79286746 AAATCAACTGTTTTTCAGTTTGG + Intronic
1027536626 7:79411294-79411316 TAATCAGCTGACCTTTAAATAGG + Intronic
1027710860 7:81599929-81599951 ATATAAGCTGCACTTCAGTTTGG - Intergenic
1028172790 7:87618706-87618728 TAATCAGTTGACCTTGAGATAGG + Intronic
1028811973 7:95098093-95098115 AAATCAGTTGACTTTAAGTAAGG - Intronic
1029867701 7:103653007-103653029 ATATCAGTTTATCTTCAGTTAGG - Intronic
1030421014 7:109306288-109306310 AAATCTACTGACCTTGGGTTTGG - Intergenic
1031386831 7:121161506-121161528 AAATCAGTTGACCTTAAATTAGG - Intronic
1031787304 7:126049458-126049480 AAATCAGTTGACCATCAATTTGG + Intergenic
1033547411 7:142413926-142413948 CAATCAGCTGACCTTCATACTGG - Intergenic
1033550162 7:142439570-142439592 CAATCAGCTGACCTTAATATAGG - Intergenic
1033578762 7:142712386-142712408 TAATCAGCCGACCTTGAGATAGG - Intergenic
1033594652 7:142849620-142849642 TAATCAGCTAACCTTGAGATGGG + Intergenic
1033707526 7:143903547-143903569 TAATTAGCTGACCTTGAGATGGG - Intergenic
1033765320 7:144483212-144483234 TAATCAGCTGACCTTAAAATAGG + Intronic
1033869387 7:145732060-145732082 TAATCACCTGACCTTGAGATGGG + Intergenic
1036279535 8:7388424-7388446 TAATCAGCTGACTTTCAAATAGG - Intergenic
1036341983 8:7923453-7923475 TAATCAGCTGACTTTCAAATAGG + Intergenic
1036342985 8:7933074-7933096 TAATCAGCTGACCTTAAAATAGG + Intronic
1036838323 8:12093831-12093853 TAATCAGCTGACCTTAAAATAGG + Intergenic
1036860113 8:12340079-12340101 TAATCAGCTGACCTTAAAATAGG + Intergenic
1036926420 8:12910309-12910331 GTATCTGCTGACCTTGAGTTTGG - Intergenic
1038214760 8:25551337-25551359 TAATCAGCTGACTTTAAGTAAGG + Intergenic
1039544126 8:38396063-38396085 AATGTAGGTGACCTTCAGTTGGG - Intronic
1040494904 8:47958039-47958061 TAATCAGCTGACCTTAAAATGGG + Intronic
1041625567 8:60022413-60022435 GAGTCAGCTGATCTTCAGCTGGG - Intergenic
1042057520 8:64781688-64781710 TAATCAGCTGACCTTAAAATAGG - Intronic
1044588528 8:93890866-93890888 AACACAGATGACCTTCACTTTGG + Intronic
1044846134 8:96383654-96383676 AAATCAACTGACCTTAAGGTGGG - Intergenic
1044942950 8:97361808-97361830 TAATCAGCTGACCTTTAAATAGG + Intergenic
1045139417 8:99263733-99263755 TAATCAGCTGACCTTGAAATAGG - Intronic
1047007231 8:120632891-120632913 AAATCAGATAACCTTAATTTAGG - Intronic
1047365219 8:124205139-124205161 TAATCAGCTGACCTTAAAATTGG + Intergenic
1048489606 8:134880461-134880483 TAATCAGCTGACTTTAAATTAGG + Intergenic
1050344164 9:4669747-4669769 TGATCAGCTGACCTTAAATTAGG - Intergenic
1051508749 9:17853795-17853817 AAATCAGCTGTGATTCTGTTGGG - Intergenic
1051630649 9:19137432-19137454 AAATCATCTGGCCTTCTGATTGG - Intronic
1051687163 9:19669794-19669816 TAATCAGCTGACCTTGAGATGGG - Intronic
1053281481 9:36822834-36822856 GAATCAGGTGAGCTTCAGTGGGG - Intergenic
1054458302 9:65447419-65447441 AAATCAGCTGACCTTCAGTTAGG - Intergenic
1055095774 9:72412629-72412651 AAATCAGCTGACCTTAAAGCAGG + Intergenic
1055307268 9:74942831-74942853 AAACCAGTTGACCTTCAGATAGG - Intergenic
1055363756 9:75522830-75522852 TAATCAGCTGACTTTGAGATTGG + Intergenic
1055748914 9:79482657-79482679 AAATCAGCTAATCTTCAATCAGG + Intergenic
1056028281 9:82524198-82524220 TGATCAGCTGACCTTAAGTTGGG - Intergenic
1056058936 9:82862304-82862326 TAATCAGCTGACCTTAAAATAGG - Intergenic
1056690097 9:88800765-88800787 AAATTATATGAACTTCAGTTTGG + Intergenic
1057543432 9:95998414-95998436 GAATCAGCTGACCTTGAGATGGG + Intronic
1057860566 9:98637509-98637531 TAATCAGCTGACCTTAAAGTAGG + Intronic
1058036995 9:100263609-100263631 TAATCAGCTGAACTTGAGATGGG - Intronic
1058573577 9:106375063-106375085 TAATCAGTTGACCTTAAGATAGG - Intergenic
1059920217 9:119151944-119151966 AAACCAGCTGACCTTGAGAATGG - Intergenic
1060506351 9:124201006-124201028 AAATCAGATTTCCGTCAGTTAGG + Intergenic
1186361669 X:8848854-8848876 TAATCAGCTGACTTTAAGTAAGG + Intergenic
1186807207 X:13152333-13152355 AATTCAGCCCACCTTCAGCTTGG - Intergenic
1186866284 X:13723887-13723909 TCATCAGCTGACCTTAAGATAGG + Intronic
1187351701 X:18524677-18524699 AATCTAGGTGACCTTCAGTTTGG - Intronic
1188149901 X:26660063-26660085 AATATAGGTGACCTTCAGTTTGG + Intergenic
1188312870 X:28639382-28639404 CAATTACCTGACCTTCAGCTAGG + Intronic
1188370256 X:29361134-29361156 ACACCAGCTAACCTTCAGTGAGG - Intronic
1190106291 X:47563169-47563191 ACATCAGCTGCGCTTCTGTTGGG + Intronic
1191579090 X:62740418-62740440 AAATCAGTTTTCCTTCAGGTGGG - Intergenic
1191859056 X:65651039-65651061 TAATCAGCTGACCTTGAGATGGG - Intronic
1191958528 X:66673199-66673221 AGATCAGCTGACCTACAGGCAGG - Intergenic
1192093675 X:68187294-68187316 TAATCAGATGACCTTGAGATAGG + Intronic
1192730173 X:73795201-73795223 TAATCAGCTGACCTTGAGATGGG + Intergenic
1192962720 X:76147268-76147290 AAGTAGGCTGACCCTCAGTTTGG - Intergenic
1193288336 X:79740018-79740040 TAATCAGCTGACCTTAAGATAGG + Intergenic
1193384517 X:80854772-80854794 AAACCAACTGACCTTAATTTTGG + Intergenic
1194403312 X:93463855-93463877 ACATATACTGACCTTCAGTTAGG - Intergenic
1195486447 X:105413323-105413345 TAATTAGCTGACCTTGAGATAGG + Intronic
1196103158 X:111868612-111868634 AAATCAGCTGACTTTGAGCTGGG + Intronic
1196531471 X:116791977-116791999 TAATCAGCTAACCTTCAGACTGG - Intergenic
1196759968 X:119192099-119192121 AAAAAAGCTGACCTTCAGGCTGG + Intergenic
1196779006 X:119365621-119365643 AAATCAGTTGACCTTAAAATAGG - Intergenic
1197124648 X:122930127-122930149 CCACCAGTTGACCTTCAGTTTGG - Intergenic
1197148237 X:123192008-123192030 AAGCCAGCTGACCTTTAGTTTGG - Intronic
1199127812 X:144144801-144144823 AAATCAGTTGATCTTAAGATAGG - Intergenic
1200173470 X:154096525-154096547 AAGTCATCTGAGTTTCAGTTTGG + Intronic
1200893018 Y:8343764-8343786 GAATCATGTCACCTTCAGTTTGG - Intergenic
1201560173 Y:15307433-15307455 TAATCAGTTGACCTTAAATTAGG - Intergenic
1202338509 Y:23835325-23835347 AAATCAGTAGGCCTTTAGTTAGG - Intergenic
1202532257 Y:25834747-25834769 AAATCAGTAGGCCTTTAGTTAGG + Intergenic