ID: 968935287

View in Genome Browser
Species Human (GRCh38)
Location 4:3607109-3607131
Sequence ATAAATAAGCAGAAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968935287_968935290 -3 Left 968935287 4:3607109-3607131 CCTCTCTGCTTCTGCTTATTTAT No data
Right 968935290 4:3607129-3607151 TATCTGCAAAATGGGCCTAGTGG No data
968935287_968935293 0 Left 968935287 4:3607109-3607131 CCTCTCTGCTTCTGCTTATTTAT No data
Right 968935293 4:3607132-3607154 CTGCAAAATGGGCCTAGTGGGGG No data
968935287_968935294 10 Left 968935287 4:3607109-3607131 CCTCTCTGCTTCTGCTTATTTAT No data
Right 968935294 4:3607142-3607164 GGCCTAGTGGGGGAGCTGTGAGG No data
968935287_968935292 -1 Left 968935287 4:3607109-3607131 CCTCTCTGCTTCTGCTTATTTAT No data
Right 968935292 4:3607131-3607153 TCTGCAAAATGGGCCTAGTGGGG No data
968935287_968935296 25 Left 968935287 4:3607109-3607131 CCTCTCTGCTTCTGCTTATTTAT No data
Right 968935296 4:3607157-3607179 CTGTGAGGATTGCATAACTGTGG No data
968935287_968935291 -2 Left 968935287 4:3607109-3607131 CCTCTCTGCTTCTGCTTATTTAT No data
Right 968935291 4:3607130-3607152 ATCTGCAAAATGGGCCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968935287 Original CRISPR ATAAATAAGCAGAAGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr