ID: 968938913

View in Genome Browser
Species Human (GRCh38)
Location 4:3627903-3627925
Sequence CCAAGGACACTTGTGGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968938901_968938913 13 Left 968938901 4:3627867-3627889 CCGAAGTGTCCTGCCTCCCAGCT No data
Right 968938913 4:3627903-3627925 CCAAGGACACTTGTGGTTGAGGG No data
968938904_968938913 -3 Left 968938904 4:3627883-3627905 CCCAGCTCCTTTCCTGTCCTCCA No data
Right 968938913 4:3627903-3627925 CCAAGGACACTTGTGGTTGAGGG No data
968938907_968938913 -10 Left 968938907 4:3627890-3627912 CCTTTCCTGTCCTCCAAGGACAC No data
Right 968938913 4:3627903-3627925 CCAAGGACACTTGTGGTTGAGGG No data
968938898_968938913 24 Left 968938898 4:3627856-3627878 CCCTGCCAAAGCCGAAGTGTCCT No data
Right 968938913 4:3627903-3627925 CCAAGGACACTTGTGGTTGAGGG No data
968938900_968938913 19 Left 968938900 4:3627861-3627883 CCAAAGCCGAAGTGTCCTGCCTC No data
Right 968938913 4:3627903-3627925 CCAAGGACACTTGTGGTTGAGGG No data
968938899_968938913 23 Left 968938899 4:3627857-3627879 CCTGCCAAAGCCGAAGTGTCCTG No data
Right 968938913 4:3627903-3627925 CCAAGGACACTTGTGGTTGAGGG No data
968938905_968938913 -4 Left 968938905 4:3627884-3627906 CCAGCTCCTTTCCTGTCCTCCAA No data
Right 968938913 4:3627903-3627925 CCAAGGACACTTGTGGTTGAGGG No data
968938902_968938913 4 Left 968938902 4:3627876-3627898 CCTGCCTCCCAGCTCCTTTCCTG No data
Right 968938913 4:3627903-3627925 CCAAGGACACTTGTGGTTGAGGG No data
968938903_968938913 0 Left 968938903 4:3627880-3627902 CCTCCCAGCTCCTTTCCTGTCCT No data
Right 968938913 4:3627903-3627925 CCAAGGACACTTGTGGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968938913 Original CRISPR CCAAGGACACTTGTGGTTGA GGG Intergenic
No off target data available for this crispr