ID: 968942024 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:3643842-3643864 |
| Sequence | GGCCGCCCGAGGAGACCTAG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 968942019_968942024 | 3 | Left | 968942019 | 4:3643816-3643838 | CCAGGTGGCGGGTGCTGGGGAAG | No data | ||
| Right | 968942024 | 4:3643842-3643864 | GGCCGCCCGAGGAGACCTAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 968942024 | Original CRISPR | GGCCGCCCGAGGAGACCTAG GGG | Intergenic | ||