ID: 968942024

View in Genome Browser
Species Human (GRCh38)
Location 4:3643842-3643864
Sequence GGCCGCCCGAGGAGACCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968942019_968942024 3 Left 968942019 4:3643816-3643838 CCAGGTGGCGGGTGCTGGGGAAG No data
Right 968942024 4:3643842-3643864 GGCCGCCCGAGGAGACCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968942024 Original CRISPR GGCCGCCCGAGGAGACCTAG GGG Intergenic