ID: 968943588

View in Genome Browser
Species Human (GRCh38)
Location 4:3652110-3652132
Sequence GTGCAGAAGCACAAGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968943588_968943593 3 Left 968943588 4:3652110-3652132 CCTTGCCCCTTGTGCTTCTGCAC No data
Right 968943593 4:3652136-3652158 CGCCCCTTGTGCTTCTGCACTGG No data
968943588_968943597 17 Left 968943588 4:3652110-3652132 CCTTGCCCCTTGTGCTTCTGCAC No data
Right 968943597 4:3652150-3652172 CTGCACTGGCACCCCTTGAGAGG No data
968943588_968943600 27 Left 968943588 4:3652110-3652132 CCTTGCCCCTTGTGCTTCTGCAC No data
Right 968943600 4:3652160-3652182 ACCCCTTGAGAGGGCAGCTTGGG No data
968943588_968943599 26 Left 968943588 4:3652110-3652132 CCTTGCCCCTTGTGCTTCTGCAC No data
Right 968943599 4:3652159-3652181 CACCCCTTGAGAGGGCAGCTTGG No data
968943588_968943598 18 Left 968943588 4:3652110-3652132 CCTTGCCCCTTGTGCTTCTGCAC No data
Right 968943598 4:3652151-3652173 TGCACTGGCACCCCTTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968943588 Original CRISPR GTGCAGAAGCACAAGGGGCA AGG (reversed) Intergenic
No off target data available for this crispr