ID: 968944152

View in Genome Browser
Species Human (GRCh38)
Location 4:3654837-3654859
Sequence CACCCCACGAGGGTCCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968944146_968944152 13 Left 968944146 4:3654801-3654823 CCTGGGTCTTGAGGTCTGTGGAG No data
Right 968944152 4:3654837-3654859 CACCCCACGAGGGTCCTGTGAGG No data
968944145_968944152 14 Left 968944145 4:3654800-3654822 CCCTGGGTCTTGAGGTCTGTGGA No data
Right 968944152 4:3654837-3654859 CACCCCACGAGGGTCCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968944152 Original CRISPR CACCCCACGAGGGTCCTGTG AGG Intergenic
No off target data available for this crispr