ID: 968947000

View in Genome Browser
Species Human (GRCh38)
Location 4:3670414-3670436
Sequence TCTCACAGGCTGATGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968947000_968947005 4 Left 968947000 4:3670414-3670436 CCAGGCACCATCAGCCTGTGAGA No data
Right 968947005 4:3670441-3670463 GGCTGCTGTGACCCCACAGGAGG No data
968947000_968947004 1 Left 968947000 4:3670414-3670436 CCAGGCACCATCAGCCTGTGAGA No data
Right 968947004 4:3670438-3670460 AGAGGCTGCTGTGACCCCACAGG No data
968947000_968947006 9 Left 968947000 4:3670414-3670436 CCAGGCACCATCAGCCTGTGAGA No data
Right 968947006 4:3670446-3670468 CTGTGACCCCACAGGAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968947000 Original CRISPR TCTCACAGGCTGATGGTGCC TGG (reversed) Intergenic
No off target data available for this crispr