ID: 968947083

View in Genome Browser
Species Human (GRCh38)
Location 4:3670778-3670800
Sequence CAGTGTGTCCGGAGCGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968947072_968947083 18 Left 968947072 4:3670737-3670759 CCAAAGGCTCCTTGCTGCCCACC No data
Right 968947083 4:3670778-3670800 CAGTGTGTCCGGAGCGTGCAGGG No data
968947076_968947083 0 Left 968947076 4:3670755-3670777 CCACCTGAGGTCCAGCACCTTGG No data
Right 968947083 4:3670778-3670800 CAGTGTGTCCGGAGCGTGCAGGG No data
968947078_968947083 -3 Left 968947078 4:3670758-3670780 CCTGAGGTCCAGCACCTTGGCAG No data
Right 968947083 4:3670778-3670800 CAGTGTGTCCGGAGCGTGCAGGG No data
968947074_968947083 9 Left 968947074 4:3670746-3670768 CCTTGCTGCCCACCTGAGGTCCA No data
Right 968947083 4:3670778-3670800 CAGTGTGTCCGGAGCGTGCAGGG No data
968947071_968947083 22 Left 968947071 4:3670733-3670755 CCTTCCAAAGGCTCCTTGCTGCC No data
Right 968947083 4:3670778-3670800 CAGTGTGTCCGGAGCGTGCAGGG No data
968947075_968947083 1 Left 968947075 4:3670754-3670776 CCCACCTGAGGTCCAGCACCTTG No data
Right 968947083 4:3670778-3670800 CAGTGTGTCCGGAGCGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968947083 Original CRISPR CAGTGTGTCCGGAGCGTGCA GGG Intergenic
No off target data available for this crispr