ID: 968947553

View in Genome Browser
Species Human (GRCh38)
Location 4:3673401-3673423
Sequence AGACCACGGTGCCCCCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968947553_968947560 1 Left 968947553 4:3673401-3673423 CCACTCTGGGGGCACCGTGGTCT No data
Right 968947560 4:3673425-3673447 TGGGATTTGGAGGCAGGTTCTGG No data
968947553_968947558 -9 Left 968947553 4:3673401-3673423 CCACTCTGGGGGCACCGTGGTCT No data
Right 968947558 4:3673415-3673437 CCGTGGTCTCTGGGATTTGGAGG No data
968947553_968947561 7 Left 968947553 4:3673401-3673423 CCACTCTGGGGGCACCGTGGTCT No data
Right 968947561 4:3673431-3673453 TTGGAGGCAGGTTCTGGAGCAGG No data
968947553_968947559 -5 Left 968947553 4:3673401-3673423 CCACTCTGGGGGCACCGTGGTCT No data
Right 968947559 4:3673419-3673441 GGTCTCTGGGATTTGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968947553 Original CRISPR AGACCACGGTGCCCCCAGAG TGG (reversed) Intergenic
No off target data available for this crispr