ID: 968947691

View in Genome Browser
Species Human (GRCh38)
Location 4:3674286-3674308
Sequence CATTCTAGGGAGGAGATAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968947691_968947698 -1 Left 968947691 4:3674286-3674308 CCGGCTATCTCCTCCCTAGAATG No data
Right 968947698 4:3674308-3674330 GTGGAGTCGGCGGCCCTCCAAGG No data
968947691_968947703 25 Left 968947691 4:3674286-3674308 CCGGCTATCTCCTCCCTAGAATG No data
Right 968947703 4:3674334-3674356 CTTGCCACCTTCCATTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968947691 Original CRISPR CATTCTAGGGAGGAGATAGC CGG (reversed) Intergenic
No off target data available for this crispr