ID: 968950259

View in Genome Browser
Species Human (GRCh38)
Location 4:3687827-3687849
Sequence GGCTCACGCCACCACCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968950259_968950267 0 Left 968950259 4:3687827-3687849 CCAGGCAGGTGGTGGCGTGAGCC No data
Right 968950267 4:3687850-3687872 GAGAGGCCAGAAGGTCTGGGGGG No data
968950259_968950274 30 Left 968950259 4:3687827-3687849 CCAGGCAGGTGGTGGCGTGAGCC No data
Right 968950274 4:3687880-3687902 GGCCACAGTCCATCTGGAGGTGG No data
968950259_968950270 6 Left 968950259 4:3687827-3687849 CCAGGCAGGTGGTGGCGTGAGCC No data
Right 968950270 4:3687856-3687878 CCAGAAGGTCTGGGGGGGACTGG No data
968950259_968950265 -2 Left 968950259 4:3687827-3687849 CCAGGCAGGTGGTGGCGTGAGCC No data
Right 968950265 4:3687848-3687870 CCGAGAGGCCAGAAGGTCTGGGG No data
968950259_968950272 24 Left 968950259 4:3687827-3687849 CCAGGCAGGTGGTGGCGTGAGCC No data
Right 968950272 4:3687874-3687896 ACTGGAGGCCACAGTCCATCTGG No data
968950259_968950263 -3 Left 968950259 4:3687827-3687849 CCAGGCAGGTGGTGGCGTGAGCC No data
Right 968950263 4:3687847-3687869 GCCGAGAGGCCAGAAGGTCTGGG No data
968950259_968950261 -9 Left 968950259 4:3687827-3687849 CCAGGCAGGTGGTGGCGTGAGCC No data
Right 968950261 4:3687841-3687863 GCGTGAGCCGAGAGGCCAGAAGG No data
968950259_968950271 9 Left 968950259 4:3687827-3687849 CCAGGCAGGTGGTGGCGTGAGCC No data
Right 968950271 4:3687859-3687881 GAAGGTCTGGGGGGGACTGGAGG No data
968950259_968950273 27 Left 968950259 4:3687827-3687849 CCAGGCAGGTGGTGGCGTGAGCC No data
Right 968950273 4:3687877-3687899 GGAGGCCACAGTCCATCTGGAGG No data
968950259_968950266 -1 Left 968950259 4:3687827-3687849 CCAGGCAGGTGGTGGCGTGAGCC No data
Right 968950266 4:3687849-3687871 CGAGAGGCCAGAAGGTCTGGGGG No data
968950259_968950268 1 Left 968950259 4:3687827-3687849 CCAGGCAGGTGGTGGCGTGAGCC No data
Right 968950268 4:3687851-3687873 AGAGGCCAGAAGGTCTGGGGGGG No data
968950259_968950262 -4 Left 968950259 4:3687827-3687849 CCAGGCAGGTGGTGGCGTGAGCC No data
Right 968950262 4:3687846-3687868 AGCCGAGAGGCCAGAAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968950259 Original CRISPR GGCTCACGCCACCACCTGCC TGG (reversed) Intergenic
No off target data available for this crispr