ID: 968951979

View in Genome Browser
Species Human (GRCh38)
Location 4:3700064-3700086
Sequence GAAGCTGCTGTGCTTGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968951968_968951979 29 Left 968951968 4:3700012-3700034 CCTCCAGTGACAAGGTTGACGGA No data
Right 968951979 4:3700064-3700086 GAAGCTGCTGTGCTTGGAATGGG No data
968951969_968951979 26 Left 968951969 4:3700015-3700037 CCAGTGACAAGGTTGACGGAGAC No data
Right 968951979 4:3700064-3700086 GAAGCTGCTGTGCTTGGAATGGG No data
968951975_968951979 -3 Left 968951975 4:3700044-3700066 CCGGGGCTCCTGCGAGGATAGAA No data
Right 968951979 4:3700064-3700086 GAAGCTGCTGTGCTTGGAATGGG No data
968951966_968951979 30 Left 968951966 4:3700011-3700033 CCCTCCAGTGACAAGGTTGACGG No data
Right 968951979 4:3700064-3700086 GAAGCTGCTGTGCTTGGAATGGG No data
968951974_968951979 -2 Left 968951974 4:3700043-3700065 CCCGGGGCTCCTGCGAGGATAGA No data
Right 968951979 4:3700064-3700086 GAAGCTGCTGTGCTTGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968951979 Original CRISPR GAAGCTGCTGTGCTTGGAAT GGG Intergenic
No off target data available for this crispr