ID: 968952536

View in Genome Browser
Species Human (GRCh38)
Location 4:3702392-3702414
Sequence CAGTCTGGGCAGTGGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968952536_968952553 21 Left 968952536 4:3702392-3702414 CCCCCCTCCCACTGCCCAGACTG No data
Right 968952553 4:3702436-3702458 CTGACCCCCCTCCCACTGCCCGG No data
968952536_968952545 -3 Left 968952536 4:3702392-3702414 CCCCCCTCCCACTGCCCAGACTG No data
Right 968952545 4:3702412-3702434 CTGACCCTCCTCCCACTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968952536 Original CRISPR CAGTCTGGGCAGTGGGAGGG GGG (reversed) Intergenic
No off target data available for this crispr