ID: 968953060

View in Genome Browser
Species Human (GRCh38)
Location 4:3704419-3704441
Sequence GTCCCCAGGGAAGAGGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968953060_968953068 13 Left 968953060 4:3704419-3704441 CCCTCAACCTCTTCCCTGGGGAC No data
Right 968953068 4:3704455-3704477 CTCTTCCCCAAGGTCCACCCTGG No data
968953060_968953067 3 Left 968953060 4:3704419-3704441 CCCTCAACCTCTTCCCTGGGGAC No data
Right 968953067 4:3704445-3704467 CACGTGGACTCTCTTCCCCAAGG No data
968953060_968953069 14 Left 968953060 4:3704419-3704441 CCCTCAACCTCTTCCCTGGGGAC No data
Right 968953069 4:3704456-3704478 TCTTCCCCAAGGTCCACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968953060 Original CRISPR GTCCCCAGGGAAGAGGTTGA GGG (reversed) Intergenic
No off target data available for this crispr