ID: 968954739

View in Genome Browser
Species Human (GRCh38)
Location 4:3712451-3712473
Sequence GAAACCTTGGTAGCTGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968954735_968954739 3 Left 968954735 4:3712425-3712447 CCTAGCGCAACAATCTCCAAGTT No data
Right 968954739 4:3712451-3712473 GAAACCTTGGTAGCTGGTGCTGG No data
968954734_968954739 8 Left 968954734 4:3712420-3712442 CCACACCTAGCGCAACAATCTCC No data
Right 968954739 4:3712451-3712473 GAAACCTTGGTAGCTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968954739 Original CRISPR GAAACCTTGGTAGCTGGTGC TGG Intergenic
No off target data available for this crispr