ID: 968955650

View in Genome Browser
Species Human (GRCh38)
Location 4:3717524-3717546
Sequence GGCCCTGCACCAACTAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968955646_968955650 1 Left 968955646 4:3717500-3717522 CCTCCGCTCTTGCTGAGCAGGTC No data
Right 968955650 4:3717524-3717546 GGCCCTGCACCAACTAGAGTGGG No data
968955644_968955650 4 Left 968955644 4:3717497-3717519 CCTCCTCCGCTCTTGCTGAGCAG No data
Right 968955650 4:3717524-3717546 GGCCCTGCACCAACTAGAGTGGG No data
968955647_968955650 -2 Left 968955647 4:3717503-3717525 CCGCTCTTGCTGAGCAGGTCTGG No data
Right 968955650 4:3717524-3717546 GGCCCTGCACCAACTAGAGTGGG No data
968955643_968955650 26 Left 968955643 4:3717475-3717497 CCAGGCAGGGCTCTGATGACTTC No data
Right 968955650 4:3717524-3717546 GGCCCTGCACCAACTAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968955650 Original CRISPR GGCCCTGCACCAACTAGAGT GGG Intergenic
No off target data available for this crispr