ID: 968955653

View in Genome Browser
Species Human (GRCh38)
Location 4:3717527-3717549
Sequence GACCCCACTCTAGTTGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968955653_968955658 0 Left 968955653 4:3717527-3717549 CCTGCACCAACTAGAGTGGGGTC No data
Right 968955658 4:3717550-3717572 CCAGCATCCACCTCCAGCGGTGG No data
968955653_968955655 -3 Left 968955653 4:3717527-3717549 CCTGCACCAACTAGAGTGGGGTC No data
Right 968955655 4:3717547-3717569 GTCCCAGCATCCACCTCCAGCGG No data
968955653_968955668 26 Left 968955653 4:3717527-3717549 CCTGCACCAACTAGAGTGGGGTC No data
Right 968955668 4:3717576-3717598 GAGGCCTGAGTGCAGGGCGGTGG No data
968955653_968955665 19 Left 968955653 4:3717527-3717549 CCTGCACCAACTAGAGTGGGGTC No data
Right 968955665 4:3717569-3717591 GTGGGTGGAGGCCTGAGTGCAGG No data
968955653_968955662 7 Left 968955653 4:3717527-3717549 CCTGCACCAACTAGAGTGGGGTC No data
Right 968955662 4:3717557-3717579 CCACCTCCAGCGGTGGGTGGAGG No data
968955653_968955666 20 Left 968955653 4:3717527-3717549 CCTGCACCAACTAGAGTGGGGTC No data
Right 968955666 4:3717570-3717592 TGGGTGGAGGCCTGAGTGCAGGG No data
968955653_968955667 23 Left 968955653 4:3717527-3717549 CCTGCACCAACTAGAGTGGGGTC No data
Right 968955667 4:3717573-3717595 GTGGAGGCCTGAGTGCAGGGCGG No data
968955653_968955671 29 Left 968955653 4:3717527-3717549 CCTGCACCAACTAGAGTGGGGTC No data
Right 968955671 4:3717579-3717601 GCCTGAGTGCAGGGCGGTGGGGG No data
968955653_968955670 28 Left 968955653 4:3717527-3717549 CCTGCACCAACTAGAGTGGGGTC No data
Right 968955670 4:3717578-3717600 GGCCTGAGTGCAGGGCGGTGGGG No data
968955653_968955660 4 Left 968955653 4:3717527-3717549 CCTGCACCAACTAGAGTGGGGTC No data
Right 968955660 4:3717554-3717576 CATCCACCTCCAGCGGTGGGTGG No data
968955653_968955659 1 Left 968955653 4:3717527-3717549 CCTGCACCAACTAGAGTGGGGTC No data
Right 968955659 4:3717551-3717573 CAGCATCCACCTCCAGCGGTGGG No data
968955653_968955669 27 Left 968955653 4:3717527-3717549 CCTGCACCAACTAGAGTGGGGTC No data
Right 968955669 4:3717577-3717599 AGGCCTGAGTGCAGGGCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968955653 Original CRISPR GACCCCACTCTAGTTGGTGC AGG (reversed) Intergenic
No off target data available for this crispr