ID: 968955658

View in Genome Browser
Species Human (GRCh38)
Location 4:3717550-3717572
Sequence CCAGCATCCACCTCCAGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968955644_968955658 30 Left 968955644 4:3717497-3717519 CCTCCTCCGCTCTTGCTGAGCAG No data
Right 968955658 4:3717550-3717572 CCAGCATCCACCTCCAGCGGTGG No data
968955653_968955658 0 Left 968955653 4:3717527-3717549 CCTGCACCAACTAGAGTGGGGTC No data
Right 968955658 4:3717550-3717572 CCAGCATCCACCTCCAGCGGTGG No data
968955652_968955658 1 Left 968955652 4:3717526-3717548 CCCTGCACCAACTAGAGTGGGGT No data
Right 968955658 4:3717550-3717572 CCAGCATCCACCTCCAGCGGTGG No data
968955647_968955658 24 Left 968955647 4:3717503-3717525 CCGCTCTTGCTGAGCAGGTCTGG No data
Right 968955658 4:3717550-3717572 CCAGCATCCACCTCCAGCGGTGG No data
968955654_968955658 -6 Left 968955654 4:3717533-3717555 CCAACTAGAGTGGGGTCCCAGCA No data
Right 968955658 4:3717550-3717572 CCAGCATCCACCTCCAGCGGTGG No data
968955646_968955658 27 Left 968955646 4:3717500-3717522 CCTCCGCTCTTGCTGAGCAGGTC No data
Right 968955658 4:3717550-3717572 CCAGCATCCACCTCCAGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968955658 Original CRISPR CCAGCATCCACCTCCAGCGG TGG Intergenic
No off target data available for this crispr