ID: 968955659

View in Genome Browser
Species Human (GRCh38)
Location 4:3717551-3717573
Sequence CAGCATCCACCTCCAGCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968955647_968955659 25 Left 968955647 4:3717503-3717525 CCGCTCTTGCTGAGCAGGTCTGG No data
Right 968955659 4:3717551-3717573 CAGCATCCACCTCCAGCGGTGGG No data
968955653_968955659 1 Left 968955653 4:3717527-3717549 CCTGCACCAACTAGAGTGGGGTC No data
Right 968955659 4:3717551-3717573 CAGCATCCACCTCCAGCGGTGGG No data
968955646_968955659 28 Left 968955646 4:3717500-3717522 CCTCCGCTCTTGCTGAGCAGGTC No data
Right 968955659 4:3717551-3717573 CAGCATCCACCTCCAGCGGTGGG No data
968955654_968955659 -5 Left 968955654 4:3717533-3717555 CCAACTAGAGTGGGGTCCCAGCA No data
Right 968955659 4:3717551-3717573 CAGCATCCACCTCCAGCGGTGGG No data
968955652_968955659 2 Left 968955652 4:3717526-3717548 CCCTGCACCAACTAGAGTGGGGT No data
Right 968955659 4:3717551-3717573 CAGCATCCACCTCCAGCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968955659 Original CRISPR CAGCATCCACCTCCAGCGGT GGG Intergenic
No off target data available for this crispr