ID: 968955660

View in Genome Browser
Species Human (GRCh38)
Location 4:3717554-3717576
Sequence CATCCACCTCCAGCGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968955647_968955660 28 Left 968955647 4:3717503-3717525 CCGCTCTTGCTGAGCAGGTCTGG No data
Right 968955660 4:3717554-3717576 CATCCACCTCCAGCGGTGGGTGG No data
968955652_968955660 5 Left 968955652 4:3717526-3717548 CCCTGCACCAACTAGAGTGGGGT No data
Right 968955660 4:3717554-3717576 CATCCACCTCCAGCGGTGGGTGG No data
968955653_968955660 4 Left 968955653 4:3717527-3717549 CCTGCACCAACTAGAGTGGGGTC No data
Right 968955660 4:3717554-3717576 CATCCACCTCCAGCGGTGGGTGG No data
968955654_968955660 -2 Left 968955654 4:3717533-3717555 CCAACTAGAGTGGGGTCCCAGCA No data
Right 968955660 4:3717554-3717576 CATCCACCTCCAGCGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968955660 Original CRISPR CATCCACCTCCAGCGGTGGG TGG Intergenic
No off target data available for this crispr