ID: 968955662

View in Genome Browser
Species Human (GRCh38)
Location 4:3717557-3717579
Sequence CCACCTCCAGCGGTGGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968955652_968955662 8 Left 968955652 4:3717526-3717548 CCCTGCACCAACTAGAGTGGGGT No data
Right 968955662 4:3717557-3717579 CCACCTCCAGCGGTGGGTGGAGG No data
968955653_968955662 7 Left 968955653 4:3717527-3717549 CCTGCACCAACTAGAGTGGGGTC No data
Right 968955662 4:3717557-3717579 CCACCTCCAGCGGTGGGTGGAGG No data
968955654_968955662 1 Left 968955654 4:3717533-3717555 CCAACTAGAGTGGGGTCCCAGCA No data
Right 968955662 4:3717557-3717579 CCACCTCCAGCGGTGGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968955662 Original CRISPR CCACCTCCAGCGGTGGGTGG AGG Intergenic
No off target data available for this crispr