ID: 968955666

View in Genome Browser
Species Human (GRCh38)
Location 4:3717570-3717592
Sequence TGGGTGGAGGCCTGAGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968955656_968955666 -2 Left 968955656 4:3717549-3717571 CCCAGCATCCACCTCCAGCGGTG No data
Right 968955666 4:3717570-3717592 TGGGTGGAGGCCTGAGTGCAGGG No data
968955652_968955666 21 Left 968955652 4:3717526-3717548 CCCTGCACCAACTAGAGTGGGGT No data
Right 968955666 4:3717570-3717592 TGGGTGGAGGCCTGAGTGCAGGG No data
968955657_968955666 -3 Left 968955657 4:3717550-3717572 CCAGCATCCACCTCCAGCGGTGG No data
Right 968955666 4:3717570-3717592 TGGGTGGAGGCCTGAGTGCAGGG No data
968955661_968955666 -10 Left 968955661 4:3717557-3717579 CCACCTCCAGCGGTGGGTGGAGG No data
Right 968955666 4:3717570-3717592 TGGGTGGAGGCCTGAGTGCAGGG No data
968955654_968955666 14 Left 968955654 4:3717533-3717555 CCAACTAGAGTGGGGTCCCAGCA No data
Right 968955666 4:3717570-3717592 TGGGTGGAGGCCTGAGTGCAGGG No data
968955653_968955666 20 Left 968955653 4:3717527-3717549 CCTGCACCAACTAGAGTGGGGTC No data
Right 968955666 4:3717570-3717592 TGGGTGGAGGCCTGAGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968955666 Original CRISPR TGGGTGGAGGCCTGAGTGCA GGG Intergenic
No off target data available for this crispr