ID: 968955671

View in Genome Browser
Species Human (GRCh38)
Location 4:3717579-3717601
Sequence GCCTGAGTGCAGGGCGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968955663_968955671 -4 Left 968955663 4:3717560-3717582 CCTCCAGCGGTGGGTGGAGGCCT No data
Right 968955671 4:3717579-3717601 GCCTGAGTGCAGGGCGGTGGGGG No data
968955657_968955671 6 Left 968955657 4:3717550-3717572 CCAGCATCCACCTCCAGCGGTGG No data
Right 968955671 4:3717579-3717601 GCCTGAGTGCAGGGCGGTGGGGG No data
968955656_968955671 7 Left 968955656 4:3717549-3717571 CCCAGCATCCACCTCCAGCGGTG No data
Right 968955671 4:3717579-3717601 GCCTGAGTGCAGGGCGGTGGGGG No data
968955652_968955671 30 Left 968955652 4:3717526-3717548 CCCTGCACCAACTAGAGTGGGGT No data
Right 968955671 4:3717579-3717601 GCCTGAGTGCAGGGCGGTGGGGG No data
968955661_968955671 -1 Left 968955661 4:3717557-3717579 CCACCTCCAGCGGTGGGTGGAGG No data
Right 968955671 4:3717579-3717601 GCCTGAGTGCAGGGCGGTGGGGG No data
968955653_968955671 29 Left 968955653 4:3717527-3717549 CCTGCACCAACTAGAGTGGGGTC No data
Right 968955671 4:3717579-3717601 GCCTGAGTGCAGGGCGGTGGGGG No data
968955664_968955671 -7 Left 968955664 4:3717563-3717585 CCAGCGGTGGGTGGAGGCCTGAG No data
Right 968955671 4:3717579-3717601 GCCTGAGTGCAGGGCGGTGGGGG No data
968955654_968955671 23 Left 968955654 4:3717533-3717555 CCAACTAGAGTGGGGTCCCAGCA No data
Right 968955671 4:3717579-3717601 GCCTGAGTGCAGGGCGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968955671 Original CRISPR GCCTGAGTGCAGGGCGGTGG GGG Intergenic
No off target data available for this crispr