ID: 968955916

View in Genome Browser
Species Human (GRCh38)
Location 4:3719353-3719375
Sequence AGGCCCCGCTGGGTGGGTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968955916_968955923 -10 Left 968955916 4:3719353-3719375 CCCGAACCCACCCAGCGGGGCCT No data
Right 968955923 4:3719366-3719388 AGCGGGGCCTGGCACCAAGCAGG No data
968955916_968955929 24 Left 968955916 4:3719353-3719375 CCCGAACCCACCCAGCGGGGCCT No data
Right 968955929 4:3719400-3719422 CCGACTTGGACCTCCTCCCACGG No data
968955916_968955931 30 Left 968955916 4:3719353-3719375 CCCGAACCCACCCAGCGGGGCCT No data
Right 968955931 4:3719406-3719428 TGGACCTCCTCCCACGGTCAGGG No data
968955916_968955925 0 Left 968955916 4:3719353-3719375 CCCGAACCCACCCAGCGGGGCCT No data
Right 968955925 4:3719376-3719398 GGCACCAAGCAGGCTGTGTGTGG No data
968955916_968955930 29 Left 968955916 4:3719353-3719375 CCCGAACCCACCCAGCGGGGCCT No data
Right 968955930 4:3719405-3719427 TTGGACCTCCTCCCACGGTCAGG No data
968955916_968955927 10 Left 968955916 4:3719353-3719375 CCCGAACCCACCCAGCGGGGCCT No data
Right 968955927 4:3719386-3719408 AGGCTGTGTGTGGACCGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968955916 Original CRISPR AGGCCCCGCTGGGTGGGTTC GGG (reversed) Intergenic
No off target data available for this crispr