ID: 968957678

View in Genome Browser
Species Human (GRCh38)
Location 4:3727488-3727510
Sequence GCAGAGATCAGGGGTCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968957678_968957685 3 Left 968957678 4:3727488-3727510 CCCCTGAGACCCCTGATCTCTGC No data
Right 968957685 4:3727514-3727536 GCCCCTATAATTACTCAGCAGGG No data
968957678_968957691 8 Left 968957678 4:3727488-3727510 CCCCTGAGACCCCTGATCTCTGC No data
Right 968957691 4:3727519-3727541 TATAATTACTCAGCAGGGGTGGG No data
968957678_968957687 4 Left 968957678 4:3727488-3727510 CCCCTGAGACCCCTGATCTCTGC No data
Right 968957687 4:3727515-3727537 CCCCTATAATTACTCAGCAGGGG No data
968957678_968957690 7 Left 968957678 4:3727488-3727510 CCCCTGAGACCCCTGATCTCTGC No data
Right 968957690 4:3727518-3727540 CTATAATTACTCAGCAGGGGTGG No data
968957678_968957684 2 Left 968957678 4:3727488-3727510 CCCCTGAGACCCCTGATCTCTGC No data
Right 968957684 4:3727513-3727535 CGCCCCTATAATTACTCAGCAGG No data
968957678_968957692 9 Left 968957678 4:3727488-3727510 CCCCTGAGACCCCTGATCTCTGC No data
Right 968957692 4:3727520-3727542 ATAATTACTCAGCAGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968957678 Original CRISPR GCAGAGATCAGGGGTCTCAG GGG (reversed) Intergenic