ID: 968958094

View in Genome Browser
Species Human (GRCh38)
Location 4:3729111-3729133
Sequence AATCCCCGATGGTGACCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968958091_968958094 -8 Left 968958091 4:3729096-3729118 CCCAACTGGGTTCAGAATCCCCG No data
Right 968958094 4:3729111-3729133 AATCCCCGATGGTGACCCAGAGG No data
968958083_968958094 27 Left 968958083 4:3729061-3729083 CCGGGGCGGTCCCTGGGCCAGCA No data
Right 968958094 4:3729111-3729133 AATCCCCGATGGTGACCCAGAGG No data
968958082_968958094 28 Left 968958082 4:3729060-3729082 CCCGGGGCGGTCCCTGGGCCAGC No data
Right 968958094 4:3729111-3729133 AATCCCCGATGGTGACCCAGAGG No data
968958086_968958094 17 Left 968958086 4:3729071-3729093 CCCTGGGCCAGCATGGGAAACAA No data
Right 968958094 4:3729111-3729133 AATCCCCGATGGTGACCCAGAGG No data
968958092_968958094 -9 Left 968958092 4:3729097-3729119 CCAACTGGGTTCAGAATCCCCGA No data
Right 968958094 4:3729111-3729133 AATCCCCGATGGTGACCCAGAGG No data
968958087_968958094 16 Left 968958087 4:3729072-3729094 CCTGGGCCAGCATGGGAAACAAC No data
Right 968958094 4:3729111-3729133 AATCCCCGATGGTGACCCAGAGG No data
968958088_968958094 10 Left 968958088 4:3729078-3729100 CCAGCATGGGAAACAACACCCAA No data
Right 968958094 4:3729111-3729133 AATCCCCGATGGTGACCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968958094 Original CRISPR AATCCCCGATGGTGACCCAG AGG Intergenic