ID: 968959330

View in Genome Browser
Species Human (GRCh38)
Location 4:3734975-3734997
Sequence GTGTGTGAAGGCGCGTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968959317_968959330 28 Left 968959317 4:3734924-3734946 CCTGAGGTCCCATCAGCCACCCC No data
Right 968959330 4:3734975-3734997 GTGTGTGAAGGCGCGTGGTGTGG No data
968959315_968959330 30 Left 968959315 4:3734922-3734944 CCCCTGAGGTCCCATCAGCCACC No data
Right 968959330 4:3734975-3734997 GTGTGTGAAGGCGCGTGGTGTGG No data
968959319_968959330 20 Left 968959319 4:3734932-3734954 CCCATCAGCCACCCCGGAGACGA No data
Right 968959330 4:3734975-3734997 GTGTGTGAAGGCGCGTGGTGTGG No data
968959320_968959330 19 Left 968959320 4:3734933-3734955 CCATCAGCCACCCCGGAGACGAG No data
Right 968959330 4:3734975-3734997 GTGTGTGAAGGCGCGTGGTGTGG No data
968959322_968959330 9 Left 968959322 4:3734943-3734965 CCCCGGAGACGAGAGACGCTCAT No data
Right 968959330 4:3734975-3734997 GTGTGTGAAGGCGCGTGGTGTGG No data
968959316_968959330 29 Left 968959316 4:3734923-3734945 CCCTGAGGTCCCATCAGCCACCC No data
Right 968959330 4:3734975-3734997 GTGTGTGAAGGCGCGTGGTGTGG No data
968959323_968959330 8 Left 968959323 4:3734944-3734966 CCCGGAGACGAGAGACGCTCATT No data
Right 968959330 4:3734975-3734997 GTGTGTGAAGGCGCGTGGTGTGG No data
968959324_968959330 7 Left 968959324 4:3734945-3734967 CCGGAGACGAGAGACGCTCATTC No data
Right 968959330 4:3734975-3734997 GTGTGTGAAGGCGCGTGGTGTGG No data
968959321_968959330 12 Left 968959321 4:3734940-3734962 CCACCCCGGAGACGAGAGACGCT No data
Right 968959330 4:3734975-3734997 GTGTGTGAAGGCGCGTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968959330 Original CRISPR GTGTGTGAAGGCGCGTGGTG TGG Intergenic
No off target data available for this crispr