ID: 968959786

View in Genome Browser
Species Human (GRCh38)
Location 4:3737657-3737679
Sequence TCCTCACTTGGAGTGAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968959786_968959792 -10 Left 968959786 4:3737657-3737679 CCTGTCTTCACTCCAAGTGAGGA No data
Right 968959792 4:3737670-3737692 CAAGTGAGGAATTGGGGGTGAGG No data
968959786_968959793 -9 Left 968959786 4:3737657-3737679 CCTGTCTTCACTCCAAGTGAGGA No data
Right 968959793 4:3737671-3737693 AAGTGAGGAATTGGGGGTGAGGG No data
968959786_968959794 -8 Left 968959786 4:3737657-3737679 CCTGTCTTCACTCCAAGTGAGGA No data
Right 968959794 4:3737672-3737694 AGTGAGGAATTGGGGGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968959786 Original CRISPR TCCTCACTTGGAGTGAAGAC AGG (reversed) Intergenic
No off target data available for this crispr