ID: 968961197

View in Genome Browser
Species Human (GRCh38)
Location 4:3744536-3744558
Sequence CATGGACTGCTGGGCGGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968961197_968961209 12 Left 968961197 4:3744536-3744558 CCCGGGCCGCCCAGCAGTCCATG No data
Right 968961209 4:3744571-3744593 AGGCGCTCCTGCCCAGGACCGGG No data
968961197_968961218 27 Left 968961197 4:3744536-3744558 CCCGGGCCGCCCAGCAGTCCATG No data
Right 968961218 4:3744586-3744608 GGACCGGGAGAAGGGGTCTGGGG No data
968961197_968961205 -8 Left 968961197 4:3744536-3744558 CCCGGGCCGCCCAGCAGTCCATG No data
Right 968961205 4:3744551-3744573 AGTCCATGGCAGGGAGACGCAGG No data
968961197_968961217 26 Left 968961197 4:3744536-3744558 CCCGGGCCGCCCAGCAGTCCATG No data
Right 968961217 4:3744585-3744607 AGGACCGGGAGAAGGGGTCTGGG No data
968961197_968961207 6 Left 968961197 4:3744536-3744558 CCCGGGCCGCCCAGCAGTCCATG No data
Right 968961207 4:3744565-3744587 AGACGCAGGCGCTCCTGCCCAGG No data
968961197_968961210 18 Left 968961197 4:3744536-3744558 CCCGGGCCGCCCAGCAGTCCATG No data
Right 968961210 4:3744577-3744599 TCCTGCCCAGGACCGGGAGAAGG No data
968961197_968961212 19 Left 968961197 4:3744536-3744558 CCCGGGCCGCCCAGCAGTCCATG No data
Right 968961212 4:3744578-3744600 CCTGCCCAGGACCGGGAGAAGGG No data
968961197_968961216 25 Left 968961197 4:3744536-3744558 CCCGGGCCGCCCAGCAGTCCATG No data
Right 968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG No data
968961197_968961213 20 Left 968961197 4:3744536-3744558 CCCGGGCCGCCCAGCAGTCCATG No data
Right 968961213 4:3744579-3744601 CTGCCCAGGACCGGGAGAAGGGG No data
968961197_968961208 11 Left 968961197 4:3744536-3744558 CCCGGGCCGCCCAGCAGTCCATG No data
Right 968961208 4:3744570-3744592 CAGGCGCTCCTGCCCAGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968961197 Original CRISPR CATGGACTGCTGGGCGGCCC GGG (reversed) Intergenic
No off target data available for this crispr