ID: 968961198

View in Genome Browser
Species Human (GRCh38)
Location 4:3744537-3744559
Sequence CCATGGACTGCTGGGCGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968961198_968961213 19 Left 968961198 4:3744537-3744559 CCGGGCCGCCCAGCAGTCCATGG No data
Right 968961213 4:3744579-3744601 CTGCCCAGGACCGGGAGAAGGGG No data
968961198_968961216 24 Left 968961198 4:3744537-3744559 CCGGGCCGCCCAGCAGTCCATGG No data
Right 968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG No data
968961198_968961218 26 Left 968961198 4:3744537-3744559 CCGGGCCGCCCAGCAGTCCATGG No data
Right 968961218 4:3744586-3744608 GGACCGGGAGAAGGGGTCTGGGG No data
968961198_968961208 10 Left 968961198 4:3744537-3744559 CCGGGCCGCCCAGCAGTCCATGG No data
Right 968961208 4:3744570-3744592 CAGGCGCTCCTGCCCAGGACCGG No data
968961198_968961210 17 Left 968961198 4:3744537-3744559 CCGGGCCGCCCAGCAGTCCATGG No data
Right 968961210 4:3744577-3744599 TCCTGCCCAGGACCGGGAGAAGG No data
968961198_968961212 18 Left 968961198 4:3744537-3744559 CCGGGCCGCCCAGCAGTCCATGG No data
Right 968961212 4:3744578-3744600 CCTGCCCAGGACCGGGAGAAGGG No data
968961198_968961207 5 Left 968961198 4:3744537-3744559 CCGGGCCGCCCAGCAGTCCATGG No data
Right 968961207 4:3744565-3744587 AGACGCAGGCGCTCCTGCCCAGG No data
968961198_968961205 -9 Left 968961198 4:3744537-3744559 CCGGGCCGCCCAGCAGTCCATGG No data
Right 968961205 4:3744551-3744573 AGTCCATGGCAGGGAGACGCAGG No data
968961198_968961209 11 Left 968961198 4:3744537-3744559 CCGGGCCGCCCAGCAGTCCATGG No data
Right 968961209 4:3744571-3744593 AGGCGCTCCTGCCCAGGACCGGG No data
968961198_968961217 25 Left 968961198 4:3744537-3744559 CCGGGCCGCCCAGCAGTCCATGG No data
Right 968961217 4:3744585-3744607 AGGACCGGGAGAAGGGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968961198 Original CRISPR CCATGGACTGCTGGGCGGCC CGG (reversed) Intergenic
No off target data available for this crispr