ID: 968961201

View in Genome Browser
Species Human (GRCh38)
Location 4:3744542-3744564
Sequence CCCTGCCATGGACTGCTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968961201_968961208 5 Left 968961201 4:3744542-3744564 CCGCCCAGCAGTCCATGGCAGGG No data
Right 968961208 4:3744570-3744592 CAGGCGCTCCTGCCCAGGACCGG No data
968961201_968961217 20 Left 968961201 4:3744542-3744564 CCGCCCAGCAGTCCATGGCAGGG No data
Right 968961217 4:3744585-3744607 AGGACCGGGAGAAGGGGTCTGGG No data
968961201_968961213 14 Left 968961201 4:3744542-3744564 CCGCCCAGCAGTCCATGGCAGGG No data
Right 968961213 4:3744579-3744601 CTGCCCAGGACCGGGAGAAGGGG No data
968961201_968961210 12 Left 968961201 4:3744542-3744564 CCGCCCAGCAGTCCATGGCAGGG No data
Right 968961210 4:3744577-3744599 TCCTGCCCAGGACCGGGAGAAGG No data
968961201_968961218 21 Left 968961201 4:3744542-3744564 CCGCCCAGCAGTCCATGGCAGGG No data
Right 968961218 4:3744586-3744608 GGACCGGGAGAAGGGGTCTGGGG No data
968961201_968961212 13 Left 968961201 4:3744542-3744564 CCGCCCAGCAGTCCATGGCAGGG No data
Right 968961212 4:3744578-3744600 CCTGCCCAGGACCGGGAGAAGGG No data
968961201_968961207 0 Left 968961201 4:3744542-3744564 CCGCCCAGCAGTCCATGGCAGGG No data
Right 968961207 4:3744565-3744587 AGACGCAGGCGCTCCTGCCCAGG No data
968961201_968961209 6 Left 968961201 4:3744542-3744564 CCGCCCAGCAGTCCATGGCAGGG No data
Right 968961209 4:3744571-3744593 AGGCGCTCCTGCCCAGGACCGGG No data
968961201_968961216 19 Left 968961201 4:3744542-3744564 CCGCCCAGCAGTCCATGGCAGGG No data
Right 968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968961201 Original CRISPR CCCTGCCATGGACTGCTGGG CGG (reversed) Intergenic
No off target data available for this crispr