ID: 968961203

View in Genome Browser
Species Human (GRCh38)
Location 4:3744545-3744567
Sequence TCTCCCTGCCATGGACTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968961203_968961212 10 Left 968961203 4:3744545-3744567 CCCAGCAGTCCATGGCAGGGAGA No data
Right 968961212 4:3744578-3744600 CCTGCCCAGGACCGGGAGAAGGG No data
968961203_968961216 16 Left 968961203 4:3744545-3744567 CCCAGCAGTCCATGGCAGGGAGA No data
Right 968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG No data
968961203_968961209 3 Left 968961203 4:3744545-3744567 CCCAGCAGTCCATGGCAGGGAGA No data
Right 968961209 4:3744571-3744593 AGGCGCTCCTGCCCAGGACCGGG No data
968961203_968961218 18 Left 968961203 4:3744545-3744567 CCCAGCAGTCCATGGCAGGGAGA No data
Right 968961218 4:3744586-3744608 GGACCGGGAGAAGGGGTCTGGGG No data
968961203_968961217 17 Left 968961203 4:3744545-3744567 CCCAGCAGTCCATGGCAGGGAGA No data
Right 968961217 4:3744585-3744607 AGGACCGGGAGAAGGGGTCTGGG No data
968961203_968961210 9 Left 968961203 4:3744545-3744567 CCCAGCAGTCCATGGCAGGGAGA No data
Right 968961210 4:3744577-3744599 TCCTGCCCAGGACCGGGAGAAGG No data
968961203_968961208 2 Left 968961203 4:3744545-3744567 CCCAGCAGTCCATGGCAGGGAGA No data
Right 968961208 4:3744570-3744592 CAGGCGCTCCTGCCCAGGACCGG No data
968961203_968961207 -3 Left 968961203 4:3744545-3744567 CCCAGCAGTCCATGGCAGGGAGA No data
Right 968961207 4:3744565-3744587 AGACGCAGGCGCTCCTGCCCAGG No data
968961203_968961213 11 Left 968961203 4:3744545-3744567 CCCAGCAGTCCATGGCAGGGAGA No data
Right 968961213 4:3744579-3744601 CTGCCCAGGACCGGGAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968961203 Original CRISPR TCTCCCTGCCATGGACTGCT GGG (reversed) Intergenic
No off target data available for this crispr