ID: 968961206

View in Genome Browser
Species Human (GRCh38)
Location 4:3744554-3744576
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968961206_968961209 -6 Left 968961206 4:3744554-3744576 CCATGGCAGGGAGACGCAGGCGC No data
Right 968961209 4:3744571-3744593 AGGCGCTCCTGCCCAGGACCGGG No data
968961206_968961212 1 Left 968961206 4:3744554-3744576 CCATGGCAGGGAGACGCAGGCGC No data
Right 968961212 4:3744578-3744600 CCTGCCCAGGACCGGGAGAAGGG No data
968961206_968961208 -7 Left 968961206 4:3744554-3744576 CCATGGCAGGGAGACGCAGGCGC No data
Right 968961208 4:3744570-3744592 CAGGCGCTCCTGCCCAGGACCGG No data
968961206_968961213 2 Left 968961206 4:3744554-3744576 CCATGGCAGGGAGACGCAGGCGC No data
Right 968961213 4:3744579-3744601 CTGCCCAGGACCGGGAGAAGGGG No data
968961206_968961210 0 Left 968961206 4:3744554-3744576 CCATGGCAGGGAGACGCAGGCGC No data
Right 968961210 4:3744577-3744599 TCCTGCCCAGGACCGGGAGAAGG No data
968961206_968961217 8 Left 968961206 4:3744554-3744576 CCATGGCAGGGAGACGCAGGCGC No data
Right 968961217 4:3744585-3744607 AGGACCGGGAGAAGGGGTCTGGG No data
968961206_968961216 7 Left 968961206 4:3744554-3744576 CCATGGCAGGGAGACGCAGGCGC No data
Right 968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG No data
968961206_968961218 9 Left 968961206 4:3744554-3744576 CCATGGCAGGGAGACGCAGGCGC No data
Right 968961218 4:3744586-3744608 GGACCGGGAGAAGGGGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968961206 Original CRISPR GCGCCTGCGTCTCCCTGCCA TGG (reversed) Intergenic
No off target data available for this crispr