ID: 968961216

View in Genome Browser
Species Human (GRCh38)
Location 4:3744584-3744606
Sequence CAGGACCGGGAGAAGGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968961197_968961216 25 Left 968961197 4:3744536-3744558 CCCGGGCCGCCCAGCAGTCCATG No data
Right 968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG No data
968961203_968961216 16 Left 968961203 4:3744545-3744567 CCCAGCAGTCCATGGCAGGGAGA No data
Right 968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG No data
968961201_968961216 19 Left 968961201 4:3744542-3744564 CCGCCCAGCAGTCCATGGCAGGG No data
Right 968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG No data
968961206_968961216 7 Left 968961206 4:3744554-3744576 CCATGGCAGGGAGACGCAGGCGC No data
Right 968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG No data
968961204_968961216 15 Left 968961204 4:3744546-3744568 CCAGCAGTCCATGGCAGGGAGAC No data
Right 968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG No data
968961198_968961216 24 Left 968961198 4:3744537-3744559 CCGGGCCGCCCAGCAGTCCATGG No data
Right 968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968961216 Original CRISPR CAGGACCGGGAGAAGGGGTC TGG Intergenic
No off target data available for this crispr