ID: 968962240

View in Genome Browser
Species Human (GRCh38)
Location 4:3751537-3751559
Sequence GTGAGGAAGAGGAGCGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968962240_968962250 30 Left 968962240 4:3751537-3751559 CCATCCTCGCTCCTCTTCCTCAC No data
Right 968962250 4:3751590-3751612 TGACACCAGAACGTGCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968962240 Original CRISPR GTGAGGAAGAGGAGCGAGGA TGG (reversed) Intergenic
No off target data available for this crispr