ID: 968962486

View in Genome Browser
Species Human (GRCh38)
Location 4:3752671-3752693
Sequence AAGGGACCCCATAGGGAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968962479_968962486 14 Left 968962479 4:3752634-3752656 CCTGGAAGACGGTGGTAGGTTGT No data
Right 968962486 4:3752671-3752693 AAGGGACCCCATAGGGAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968962486 Original CRISPR AAGGGACCCCATAGGGAAGT CGG Intergenic
No off target data available for this crispr