ID: 968962858

View in Genome Browser
Species Human (GRCh38)
Location 4:3753937-3753959
Sequence CCCGCCTGCCGCGGTCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968962858_968962864 -8 Left 968962858 4:3753937-3753959 CCTCCAAGACCGCGGCAGGCGGG No data
Right 968962864 4:3753952-3753974 CAGGCGGGGGTCCTGTGACCTGG No data
968962858_968962865 -1 Left 968962858 4:3753937-3753959 CCTCCAAGACCGCGGCAGGCGGG No data
Right 968962865 4:3753959-3753981 GGGTCCTGTGACCTGGAACCAGG No data
968962858_968962874 29 Left 968962858 4:3753937-3753959 CCTCCAAGACCGCGGCAGGCGGG No data
Right 968962874 4:3753989-3754011 CCTCCTCGGTCATGAAAAGGAGG No data
968962858_968962872 26 Left 968962858 4:3753937-3753959 CCTCCAAGACCGCGGCAGGCGGG No data
Right 968962872 4:3753986-3754008 GTGCCTCCTCGGTCATGAAAAGG No data
968962858_968962867 3 Left 968962858 4:3753937-3753959 CCTCCAAGACCGCGGCAGGCGGG No data
Right 968962867 4:3753963-3753985 CCTGTGACCTGGAACCAGGAAGG No data
968962858_968962870 15 Left 968962858 4:3753937-3753959 CCTCCAAGACCGCGGCAGGCGGG No data
Right 968962870 4:3753975-3753997 AACCAGGAAGGGTGCCTCCTCGG No data
968962858_968962868 4 Left 968962858 4:3753937-3753959 CCTCCAAGACCGCGGCAGGCGGG No data
Right 968962868 4:3753964-3753986 CTGTGACCTGGAACCAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968962858 Original CRISPR CCCGCCTGCCGCGGTCTTGG AGG (reversed) Intergenic