ID: 968962862

View in Genome Browser
Species Human (GRCh38)
Location 4:3753940-3753962
Sequence ACCCCCGCCTGCCGCGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968962862_968962867 0 Left 968962862 4:3753940-3753962 CCAAGACCGCGGCAGGCGGGGGT No data
Right 968962867 4:3753963-3753985 CCTGTGACCTGGAACCAGGAAGG No data
968962862_968962865 -4 Left 968962862 4:3753940-3753962 CCAAGACCGCGGCAGGCGGGGGT No data
Right 968962865 4:3753959-3753981 GGGTCCTGTGACCTGGAACCAGG No data
968962862_968962870 12 Left 968962862 4:3753940-3753962 CCAAGACCGCGGCAGGCGGGGGT No data
Right 968962870 4:3753975-3753997 AACCAGGAAGGGTGCCTCCTCGG No data
968962862_968962874 26 Left 968962862 4:3753940-3753962 CCAAGACCGCGGCAGGCGGGGGT No data
Right 968962874 4:3753989-3754011 CCTCCTCGGTCATGAAAAGGAGG No data
968962862_968962868 1 Left 968962862 4:3753940-3753962 CCAAGACCGCGGCAGGCGGGGGT No data
Right 968962868 4:3753964-3753986 CTGTGACCTGGAACCAGGAAGGG No data
968962862_968962872 23 Left 968962862 4:3753940-3753962 CCAAGACCGCGGCAGGCGGGGGT No data
Right 968962872 4:3753986-3754008 GTGCCTCCTCGGTCATGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968962862 Original CRISPR ACCCCCGCCTGCCGCGGTCT TGG (reversed) Intergenic