ID: 968962863

View in Genome Browser
Species Human (GRCh38)
Location 4:3753946-3753968
Sequence CACAGGACCCCCGCCTGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968962863_968962870 6 Left 968962863 4:3753946-3753968 CCGCGGCAGGCGGGGGTCCTGTG No data
Right 968962870 4:3753975-3753997 AACCAGGAAGGGTGCCTCCTCGG No data
968962863_968962867 -6 Left 968962863 4:3753946-3753968 CCGCGGCAGGCGGGGGTCCTGTG No data
Right 968962867 4:3753963-3753985 CCTGTGACCTGGAACCAGGAAGG No data
968962863_968962872 17 Left 968962863 4:3753946-3753968 CCGCGGCAGGCGGGGGTCCTGTG No data
Right 968962872 4:3753986-3754008 GTGCCTCCTCGGTCATGAAAAGG No data
968962863_968962868 -5 Left 968962863 4:3753946-3753968 CCGCGGCAGGCGGGGGTCCTGTG No data
Right 968962868 4:3753964-3753986 CTGTGACCTGGAACCAGGAAGGG No data
968962863_968962874 20 Left 968962863 4:3753946-3753968 CCGCGGCAGGCGGGGGTCCTGTG No data
Right 968962874 4:3753989-3754011 CCTCCTCGGTCATGAAAAGGAGG No data
968962863_968962865 -10 Left 968962863 4:3753946-3753968 CCGCGGCAGGCGGGGGTCCTGTG No data
Right 968962865 4:3753959-3753981 GGGTCCTGTGACCTGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968962863 Original CRISPR CACAGGACCCCCGCCTGCCG CGG (reversed) Intergenic