ID: 968962864

View in Genome Browser
Species Human (GRCh38)
Location 4:3753952-3753974
Sequence CAGGCGGGGGTCCTGTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968962846_968962864 24 Left 968962846 4:3753905-3753927 CCTTCCCTCCCAGCTACGAAGGC No data
Right 968962864 4:3753952-3753974 CAGGCGGGGGTCCTGTGACCTGG No data
968962848_968962864 20 Left 968962848 4:3753909-3753931 CCCTCCCAGCTACGAAGGCAGGG No data
Right 968962864 4:3753952-3753974 CAGGCGGGGGTCCTGTGACCTGG No data
968962852_968962864 16 Left 968962852 4:3753913-3753935 CCCAGCTACGAAGGCAGGGGCGG No data
Right 968962864 4:3753952-3753974 CAGGCGGGGGTCCTGTGACCTGG No data
968962844_968962864 25 Left 968962844 4:3753904-3753926 CCCTTCCCTCCCAGCTACGAAGG No data
Right 968962864 4:3753952-3753974 CAGGCGGGGGTCCTGTGACCTGG No data
968962854_968962864 15 Left 968962854 4:3753914-3753936 CCAGCTACGAAGGCAGGGGCGGA No data
Right 968962864 4:3753952-3753974 CAGGCGGGGGTCCTGTGACCTGG No data
968962850_968962864 19 Left 968962850 4:3753910-3753932 CCTCCCAGCTACGAAGGCAGGGG No data
Right 968962864 4:3753952-3753974 CAGGCGGGGGTCCTGTGACCTGG No data
968962858_968962864 -8 Left 968962858 4:3753937-3753959 CCTCCAAGACCGCGGCAGGCGGG No data
Right 968962864 4:3753952-3753974 CAGGCGGGGGTCCTGTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968962864 Original CRISPR CAGGCGGGGGTCCTGTGACC TGG Intergenic