ID: 968962867

View in Genome Browser
Species Human (GRCh38)
Location 4:3753963-3753985
Sequence CCTGTGACCTGGAACCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968962862_968962867 0 Left 968962862 4:3753940-3753962 CCAAGACCGCGGCAGGCGGGGGT No data
Right 968962867 4:3753963-3753985 CCTGTGACCTGGAACCAGGAAGG No data
968962850_968962867 30 Left 968962850 4:3753910-3753932 CCTCCCAGCTACGAAGGCAGGGG No data
Right 968962867 4:3753963-3753985 CCTGTGACCTGGAACCAGGAAGG No data
968962863_968962867 -6 Left 968962863 4:3753946-3753968 CCGCGGCAGGCGGGGGTCCTGTG No data
Right 968962867 4:3753963-3753985 CCTGTGACCTGGAACCAGGAAGG No data
968962854_968962867 26 Left 968962854 4:3753914-3753936 CCAGCTACGAAGGCAGGGGCGGA No data
Right 968962867 4:3753963-3753985 CCTGTGACCTGGAACCAGGAAGG No data
968962858_968962867 3 Left 968962858 4:3753937-3753959 CCTCCAAGACCGCGGCAGGCGGG No data
Right 968962867 4:3753963-3753985 CCTGTGACCTGGAACCAGGAAGG No data
968962852_968962867 27 Left 968962852 4:3753913-3753935 CCCAGCTACGAAGGCAGGGGCGG No data
Right 968962867 4:3753963-3753985 CCTGTGACCTGGAACCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968962867 Original CRISPR CCTGTGACCTGGAACCAGGA AGG Intergenic