ID: 968962869

View in Genome Browser
Species Human (GRCh38)
Location 4:3753970-3753992
Sequence GAGGCACCCTTCCTGGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968962869_968962874 -4 Left 968962869 4:3753970-3753992 CCTGGAACCAGGAAGGGTGCCTC No data
Right 968962874 4:3753989-3754011 CCTCCTCGGTCATGAAAAGGAGG No data
968962869_968962872 -7 Left 968962869 4:3753970-3753992 CCTGGAACCAGGAAGGGTGCCTC No data
Right 968962872 4:3753986-3754008 GTGCCTCCTCGGTCATGAAAAGG No data
968962869_968962876 14 Left 968962869 4:3753970-3753992 CCTGGAACCAGGAAGGGTGCCTC No data
Right 968962876 4:3754007-3754029 GGAGGAATGTGCCTCCTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968962869 Original CRISPR GAGGCACCCTTCCTGGTTCC AGG (reversed) Intergenic